A Contribution to Performance Analysis Approach of the IEEE 802.11 EDCA in Wireless Multi-hop Networks

... string topology It is clear that, the lack of input factors in analytical model can lead to its inaccuracy in the performance analysis problem [10] Analytical Model To our best knowledge, there ... model of 802.11 DCF based on Markov chains to analyze the performance of IEEE 802.11e EDCA in multihop networks By dividing it into two joint state models, th...

Ngày tải lên: 13/08/2015, 10:00

... In IEEE 802.11, when a node completes its data transmission, it obtains another Backoff value via the Backoff procedure before it starts another round of data transmission If the Backoff value ... because there are k nodes on average trying to transmit data packets simultaneously, and hence k nodes on average may obtain a Backoff value of The DCW did not take the phenomen...

Ngày tải lên: 20/06/2014, 22:20

... A NEW NUMERICAL PERFORMANCE ANALYSIS METHOD OF LEAKY BUCKET POLICING ALGORITHM OVER HEAVY- TAILED ON/ OFF INTERNET TRAFFIC LUO HAIHONG (B Eng (Hons.), Southeast University, China) A THESIS ... significant complexity into the application of this classical analysis method 1.3 Motivation of this work Since heavy- tailed ON/ OFF sources are dominat...

Ngày tải lên: 16/09/2015, 15:43

... the two major areas related to the work described herein These are the study of TCP performance in ad hoc networks and the mathematical approaches to model TCP in the Internet 2.1 2.1.1 TCP in ... THE STUDY OF TCP PERFORMANCE IN IEEE 802. 11 BASED MOBILE AD HOC NETWORKS LI XIA (B Sc., Nan Jing University, PRC ) A THESIS SUBMITTED FO...

Ngày tải lên: 13/09/2015, 21:25

... world In the paper, we presented an analytical modeling to formulate the hop-distance relationship considering the quasi-UDG model Senor nodes are randomly distributed in a circular region according ... developed hop-distance relationship considering the quasi-UDG model in WSN localizations We designed a LS-based localization algorithm using our developed relationship...

Ngày tải lên: 20/06/2014, 22:20

... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc...

Ngày tải lên: 03/11/2012, 10:58

... footfall sound in plywood with a cork surface layer The refraction of materials in the whole profile and also in separate layers was not examined The failure of materials at separate layer interface ... owing to shear in bending oneself partially approved This is again a theme of another research inclusive of determination of the elastic constant according to separ...

Ngày tải lên: 07/08/2014, 04:20

... kind of plywood is available Plywoods differ in many factors Conclusion The aim of the paper was to propose the methodology of testing the abrasion resistance of combined water-proof plywood materials ... periods of monitoring, then the replacement of the sanding paper subject to the irregular course of abrasion has to be carried out at a half numbe...

Ngày tải lên: 07/08/2014, 10:21

... Quercus robur L and Q pe(Matt) Liebl: a multivariate approach to the hybrid problem Data acquisition analysis and interpretation Watsonia 12, 81-101 Rushton BS (1983) An analysis of variation of traea ... 18 and 25 mm in sessile oak This variation covers about 60% of the trees classified here as pedunculate oaks and only 30% of the sessile oaks The qu...

Ngày tải lên: 08/08/2014, 19:21

... ventrally on tail Large triangular melanopore laterally over hypural bones, dorsal and anal fin Page 31 A guide to larvae and juveniles of some common fish species from the Mekong River Basin day ... laterally Dorsally and laterally on head and body Ventrally on tail Dorsal-fin spine, anterior, distal half of dorsal fin Page 37 A guide to larvae...

Ngày tải lên: 14/03/2014, 08:46

... Council of Deans and Heads of UK University Faculties for Nursing and Health Professionals Council of Deans of Nursing and Midwifery (Australia and New Zealand) Forum of University Nursing Deans in ... American Association of Colleges of Nursing (2011) 2010-2011 Enrollment and graduations in baccalaureate and graduate programs in nursing Washington,...

Ngày tải lên: 14/03/2014, 21:20

... to 15 lm for P50H, H50P, P128H, H128P, PigE17DCPT1B and HumanD17ECPT1B, and from to 500 lm for D18PigCPT1B and D28PigCPT1B) The assay was performed at mm carnitine as standard To analyze PigE17DCPT1B ... is responsible for the peculiar characteristics of the pig enzyme (low carnitine Km and high malonylCoA IC50) and, whereas Glu17 acts as a neg...

Ngày tải lên: 16/03/2014, 04:20

... ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the ... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Angu...

Ngày tải lên: 16/03/2014, 14:20

... oligonucleotides were 5¢- GTAACTGTAAGAGAACTGGTCAC- 3¢ (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- 3¢ (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- 3¢ (Lys70 to Tyr) The resulting plasmids, pUCYPKR, ... spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was con...

Ngày tải lên: 23/03/2014, 17:21