A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants) pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

... A STUDY TO INDICATE THE IMPORTANCE OF CONSUMER BASED -BRAND EQUITY ON CONSUMER PERCEPTION OF BRAND (A CASE STUDY OF FAST FOOD RESTAURANTS)Master Thesis in Business AdministrationPriscillia ... competitive advantage of the fast food restaurant. The basic attribute of a fast food restaurant are also important for a fast food r...
A computational study to investigate the effects of insulation and EGR in a diesel engine

A computational study to investigate the effects of insulation and EGR in a diesel engine

... also adding EGR to the initial charge of adiabatic case at two load operating conditions: a full load and a part load (50% load). At all the cases, engine speed is 730rev/min. All the wall boundaries ... right half of bowl is larger than that of left half of bowl. At 400°CA, the shape of high temperature regions for baseline and adiabatic with EGR cases are the sam...
Ngày tải lên : 05/09/2013, 16:11
  • 20
  • 643
  • 0
Analytical study to minimize the engine exhaust emissions and safe knock limit of CNG powered four-stroke SI engine

Analytical study to minimize the engine exhaust emissions and safe knock limit of CNG powered four-stroke SI engine

... variation is due to the variation in the spherical burning area, produced by variation in the position of the wall contact flame center and variation in the laminar flame speed at the spark center. ... Validation The results of the computational model are verified against the experimental data of the gasoline fueled engine used by Baruah et al. [35], CNG fueled eng...
Ngày tải lên : 05/09/2013, 15:28
  • 22
  • 362
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk...
Ngày tải lên : 19/02/2014, 17:20
  • 12
  • 616
  • 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... present case. The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity. Enhanced Ras maturation by heat stress was associated with a heightened activation of extra- cellular ... DPH and (A) the effects of heat or (B) different concentrations of BA or HE on the steady-state fluorescence anisotropy were measured. The arrows indicate...
Ngày tải lên : 07/03/2014, 12:20
  • 10
  • 452
  • 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

... Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities. Other facilities or amenities in the area and appropriateness for the theme of the event ... contribution to sustainable development and reduce their environmental impacts but one area that is often overlooked is the use of resources and the release of carbon...
Ngày tải lên : 16/03/2014, 19:20
  • 5
  • 527
  • 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... consideration. A ssigning weights of  importance to evaluation criteria accounts for: (i) the changes in the range of variation for each evaluation criterion and (ii) the ... a problem,manymeasureswouldbesuggested. The responsibility of the scientistsis to screen amongthese alternatives the feasiblemeasures based on applicability and suitabil...
Ngày tải lên : 22/03/2014, 12:20
  • 13
  • 487
  • 0
Money and happiness a guide to living the good life

Money and happiness a guide to living the good life

... life that’s unsustainable and results in massive debt, because there is no rational connection between the goals and the money. That connection is essential. I occasionally get e-mails from readers ... it maximizes their happi- ness. They have defined the good life” in a way that’s authentic to them, and use money to realize a personal vision. Back in the 1990s, I worked as a...
Ngày tải lên : 12/03/2014, 14:51
  • 258
  • 358
  • 0
the impact of accounting information on management’s decision making vinamilk case study

the impact of accounting information on management’s decision making vinamilk case study

... methods can be used within a case study. When to consider the scope of qualitative research, the case study approach are adaptable for exploratory investigations of management questions. And after ... information from a company's financial statements. Financial ratios also give a financial analyst and management an excellent picture of a company's situa...
Ngày tải lên : 13/03/2014, 14:20
  • 56
  • 1.8K
  • 3

Xem thêm

Từ khóa: