... A STUDY TO INDICATE THE IMPORTANCE OF CONSUMER BASED -BRAND EQUITY ON CONSUMER PERCEPTION OF BRAND (A CASE STUDY OF FAST FOOD RESTAURANTS)Master Thesis in Business AdministrationPriscillia ... competitive advantage of the fast food restaurant. The basic attribute of a fast food restaurant are also important for a fast food r...
... also adding EGR to the initial charge of adiabatic case at two load operating conditions: a full load and a part load (50% load). At all the cases, engine speed is 730rev/min. All the wall boundaries ... right half of bowl is larger than that of left half of bowl. At 400°CA, the shape of high temperature regions for baseline and adiabatic with EGR cases are the sam...
... variation is due to the variation in the spherical burning area, produced by variation in the position of the wall contact flame center and variation in the laminar flame speed at the spark center. ... Validation The results of the computational model are verified against the experimental data of the gasoline fueled engine used by Baruah et al. [35], CNG fueled eng...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk...
... present case. The heat-induced activation
of kinases such as Akt has been shown to increase
HSF1 activity. Enhanced Ras maturation by heat stress
was associated with a heightened activation of extra-
cellular ... DPH and (A) the effects of heat or (B) different concentrations of BA or HE on the steady-state fluorescence
anisotropy were measured. The arrows indicate...
... Choice (and audio visual)
Suitability of the venue can mean more than just its
layout and facilities. Other facilities or amenities in the
area and appropriateness for the theme of the event ...
contribution to sustainable development and reduce
their environmental impacts but one area that is often
overlooked is the use of resources and the release of
carbon...
... consideration. A ssigning
weights of
importance to evaluation criteria
accounts for: (i) the changes in the range of
variation for each evaluation criterion and (ii)
the ... a
problem,manymeasureswouldbesuggested.
The responsibility of the scientistsis to screen
amongthese
alternatives the feasiblemeasures
based on applicability and suitabil...
... life that’s unsustainable and
results in massive debt, because there is no rational connection between
the goals and the money. That connection is essential. I occasionally get
e-mails from readers ... it maximizes their happi-
ness. They have defined the good life” in a way that’s authentic to
them, and use money to realize a personal vision.
Back in the 1990s, I worked as a...
... methods can be used within a case study. When to consider the scope of
qualitative research, the case study approach are adaptable for exploratory investigations
of management questions. And after ... information from a company's
financial statements. Financial ratios also give a financial analyst and management an
excellent picture of a company's situa...