Identification and Documentation of Modern Heritage

... ownership of the fuel and power industries, the iron and steel industry and of inland transport as well as of the Bank of England; the establishment of a national health service and the improvement of ... participation, of urban forms of life, and of formal schooling; to the secularization of values and norms; and so on.3 In short, our view of the world, ou...

Ngày tải lên: 07/08/2015, 15:11

... (particularly the short ones) have all zeroes in them In other words, none of the bigrams from the training set appears in these reviews This suggests that the main problem with the bigram model ... and E Hovy 2004 Determining the sentiment of opinions In Proc of COLING, pages 1367–1373 M Koppel and J Schler 2005 Using neutral examples for learning polarity In...

Ngày tải lên: 17/03/2014, 04:20

... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay...

Ngày tải lên: 23/03/2014, 21:20

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

... recovery and plasticity with brain stimulation? One of the contemporary methods under investigation as a tool to promote neuroplasticity is non-invasive brain stimulation The concept of treating ... This was based on the understanding of neurological dysfunction at the time, and the observation that patients appeared to tolerate and benefit from physical inte...

Ngày tải lên: 19/06/2014, 08:20

... The standardization and testing were carried out on separate sets of images, two for training and 12 for testing The number of samples used for standardization was 4, and 10 for the A, B, and C ... for inoculation Electron microscopy In order to examine virus-infected cells by electron microscopy, uninfected and HCMV-infected cells were harvested at 1, 3, 5, and dpi and...

Ngày tải lên: 20/06/2014, 01:20

... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatos...

Ngày tải lên: 20/06/2014, 07:20

... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine...

Ngày tải lên: 21/06/2014, 05:20

... promotion of cultural heritage in Thua Thien Hue and their reasons Limitations in the preservation and promotion of cultural heritage in Thua Thien Hue Limitations and inadequacies in the preservation ... OF CULTURAL HERITAGE IN THUA THIEN HUE AT PRESENT 3.2.1 Characteristics of cultural heritages in Thua Thien Hue Through th...

Ngày tải lên: 14/07/2014, 13:33

... approach of identifying and studying the mechanism of action of small-molecule agonists (and antagonists), we hoped to uncover some of the complexities of the Hh-signaling system Small-molecule modulators ... activation with a Hh-protein ligand has therapeutic value [49,50] On the basis of our current understanding of these models and the specific mechanism of action...

Ngày tải lên: 06/08/2014, 18:20

... predominant species of tick and often found in association with humans and animals in Korea [18] The prevalence of E chaffeensis infection in 4.3% ticks observed in this study indicate that H longicornis ... study showing the genetic analysis of E chaffenesis in H longicornis ticks collected in Korea Our findings suggests that E chaffeensis may be w...

Ngày tải lên: 07/08/2014, 18:21

... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS partic...

Ngày tải lên: 09/08/2014, 08:22

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining lay...

Ngày tải lên: 09/08/2014, 10:20