The benefits and limitations of a genre - based approach to teaching writing to grade 10 students in Tan Trao high schoool, Tuyen Quang province
... Benefits of G.B .A on students writing proficiency 3 5-3 6-3 7 3.1.2 Limitations of G.B .A to teaching writing 3 7-3 8 3.2 Summary 3 8-3 9 CONCLUSION 1 .The benefits and limitations of the genre- based approach ... a genre based approach to teaching writing ? 6-7 1.2.2 Definitions 7-8 1.2.3 Genre- Based Approach (G.B .A) 1.2.4...
Ngày tải lên: 04/08/2015, 09:42
... impacts the personal recount writing of students in Tuyen Quang Gifted High School, Tuyen Quang, Vietnam Benefits and Limitations of Genre based approach to teaching writing The application of the genre-based ... learning, including the learning of writing skills The final influential factor of genre-based approach considered in this paper i...
Ngày tải lên: 30/03/2015, 14:29
... performance The research focused only on the students‘ difficulties in learning the writing skill and the impact of genre-based approach to their writing performance at Tuyen Quang Gifted High School, Tuyen ... This research method was aimed at providing information on students‘ attitudes towards, and opinions about, the genre-based approac...
Ngày tải lên: 04/08/2015, 09:41
A systems-based approach to assessing leadership styles in engineers
... Text Mining Text mining is an “area within data mining that focuses on data from textual sources” (Feldman, 2003; Ye, 2003) Text mining is a large subfield of data mining It is an area that has developed ... research data are compared to the leadership skills needed that industry communicates in trade journals This comparison is determined using a subjective and approximate reasoning...
Ngày tải lên: 01/06/2014, 13:57
A STUDY ON HOW TO TEACH SPEAKING COMMUNICATIVELY TO GRADE 10 STUDENTS AT TRAN PHU HIGH SCHOOL
... initiate oral communication: Teachers should allow learners to initiate language because parts of oral communication competence is the ability to initiate conversation, to nominate topics , to ask questions, ... the teachers’ solution to motivating and encouraging students to participate in speaking activities Solution to motivating and encouraging students to participat...
Ngày tải lên: 07/09/2013, 13:02
WHAT IS BETA GLUCAN? A Concise Guide to the Benefits and Uses of the Most Powerful Natural Im- mune Enhancer Known to Science ppt
... adjuvant alternative, to Freund’s complete adjuvant and may be of value in immunization against visceral leishmaniasis” (Leishmania infantum was the bacteria they used in this experiment) At the Tokyo ... given beta glucan Their average age was 52, and their cancer was in the advanced stage It was concluded, Beta glucan administration seems to stimulate proliferation and...
Ngày tải lên: 31/03/2014, 22:20
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
... designed and managed the valuation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript All authors read and approved the final manuscript Acknowledgements ... state Validation of the preference based CAMPHOR scale A majority (87.8%) of the 91 participants in the CAMPHOR validation survey were in New Y...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx
... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotI...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Practising evidence-based medicine: the design and implementation of a multidisciplinary team-driven extubation protocol" pptx
... potentially accelerate decision-making with regard to extubation; and to assess the safety and feasibility of our approach Materials and method The intervention was carried out in a 14-bed medical/surgical ... evidence-based medicine into the setting of the ICU by promoting a multidisciplinary approach to extubation, and to design a protocol that was acceptab...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: "Assessment of the effects and limitations of the 1998 to 2008 Abbreviated Injury Scale map using a large " pot
... Assessment of the effects and limitations of the 1998 to 2008 Abbreviated Injury Scale map using a large population-based dataset Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... AIS08 mapping, and potentially the accuracy of the ISS calculation, in 33.0% of study patients and prevented the calculation of any ISS va...
Ngày tải lên: 13/08/2014, 23:20
The Design and Implementation of a Log-Structured File System
... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repositor...
Ngày tải lên: 12/09/2012, 15:05
the meaning and structure of a narrative a systemic functional analysis
... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis ... explore the meaning and structure of Torquay? But I said Turkey! as a text The analysis is based on the framework of Hallidays (1994)An Introducti...
Ngày tải lên: 07/09/2013, 13:48
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... The meaning and structure of a science fiction story: A sysyemic 29 Clauses and Clause Complexes Analysis The analysis of the text into clauses and clause complexes and their logico-semantic ... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declar...
Ngày tải lên: 12/02/2014, 20:20
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc
... registration, location, and actiThe CORBA Event Service model simplifies application vation; request demultiplexing; framing and error-handling; parameter marshalling and demarshalling; and operation ... filtering and corINTERFACES INTERFACES FACILITIES relation mechanisms To alleviate the limitations with the standard CORBA Event Service, we have developed a Real-ti...
Ngày tải lên: 19/02/2014, 18:20
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx
... server translates the information returned by the Sentinels into CycL and adds it to the KB This approach is potentially vulnerable to an attack on the Sentinels themselves, or to spoofing of their ... 95/98/NT/2000/XP, Linux RedHat and Solaris The Attack Planner enables the user to state plan goals, launch the planner and view the attack plans generated For exampl...
Ngày tải lên: 05/03/2014, 23:20