Learning Buil a Strong Vocabulary_2
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... investigation of the prognostic value of circulating Ang-2 as a biomarker in criti- cally ill patients. The results are that: critically ill patients are characterised by an excess of circulating Ang-2 in ... cohort study [22], Ang- 2 correlated with mortality in a univariate analysis. In a surgical population with ARDS, Ang-2 predicted death with a similar d...
Ngày tải lên: 25/10/2012, 10:31
Learning JavaScript A Hands-On Guide to the Fundamentals of Modern JavaScript
... first attempt at stan- dardization/merging of JavaScript and Jscript was called EMCAScript. This new language was more of a standardized version of JavaScript, but we still called it JavaScript, ... ptg8286261 Learning JavaScript A Hands-On Guide to the Fundamentals of Modern JavaScript Tim Wright Upper Saddle River, NJ ã Boston ã Indianapolis • San Franci...
Ngày tải lên: 03/01/2013, 15:51
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and TEHA4: ACACCCATGGT- CTGTTTCCTGTG ... bacterial strain and the solubility of the target protein are other parameters that affect total protein production, as well as the amount of soluble protein. Commonly used p...
Ngày tải lên: 06/03/2014, 01:20
THE PRESIDENT’S PLAN FOR A STRONG MIDDLE CLASS & A STRONG AMERICA pptx
... calling on the House to move swiftly to do the same, because we can’t afford to wait for the House to act any longer. THE PRESIDENT’S PLAN FOR A STRONG MIDDLE CLASS & A STRONG AMERICA WHITEHOUSE.GOV FEBRUARY, ... in early learning so that every child has EMBARGOED UNTIL DELIVERY OF THE PRESIDENT’S STATE OF THE UNION ADDRESS The President’s P...
Ngày tải lên: 08/03/2014, 06:20
e learning putting a world class education at the fingertips ppt
...
Ngày tải lên: 09/03/2014, 09:20
Essential Academic Learning Requirements: A Recommended Grade-by-Grade Sequence for Grade Level Expectations – Grades K-12 pot
... control of disease. Health and Fitness Standards Essential Academic Learning Requirements: A Recommended Grade- by -Grade Sequence for Grade Level Expectations – Grades K-12 ... developmentally appropriate. December 2008 page 13 UNDERSTANDING GRADE LEVEL EXPECTATIONS (GLES) Essential Academic Learning Requirement (EALR): A...
Ngày tải lên: 14/03/2014, 20:20
Báo cáo khoa học: "Bayesian Learning of a Tree Substitution Grammar" potx
... obvious way to learn these grammars. In particular, learning procedures are not able to take direct advantage of manually an- notated corpora like the Penn Treebank, which are not marked for derivations ... use of larger subtrees did correlate with accuracy; however, the low overall accuracy (and the fact that there are so many of these large sub- trees available in the grammar) sugge...
Ngày tải lên: 17/03/2014, 02:20
Learning Processing - A Beginner’s Guide to Programming Images, Animation, and Interaction doc
... Learning Processing A Beginner’s Guide to Programming Images, Animation, and Interaction 10 Learning Processing By adding the stroke( ) and fi ll( ) functions before the shape is drawn, ... what used to take you a whole day to program can be done in fi ve minutes. And it works on a Mac. And a PC! And a toaster oven! And you can program your pets...
Ngày tải lên: 17/03/2014, 12:20
LEARNING FROM A LEGEND: HOW WARREN MADE HIS BILLIONS pot
... great, although staring at a 1.1 or 1.2 isn’t going to steer me away from a company. How does PEG work? Let’s say a company has a P/E of 12. And that company has projected annual earnings ... who run it. Apart from good management, you’d want quality products and services and a company you understand. Let’s take these one at a time. ã Management. Warren puts stro...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... of two SMT systems in paraphrase generation, enables optimization of the final para- phrase quality. Furthermore, a revised BLEU score that balances between paraphrase adequacy and dis- similarity ... propose a joint learning method of two SMT sys- tems for paraphrase generation. The jointly-learned dual SMT system: (1) Adapts the SMT systems so that they are tun...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt
... transporter mutants (Eur. J. Biochem. 270) 3195 Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane ... aromatic amino acids, might be causing an unusually high sensitivity to weak organic acid stress. Auxotrophic requirements...
Ngày tải lên: 23/03/2014, 21:20
