Just as a time expression

... he also makes a distinction between task-based teaching and task- supported teaching. The task-based teaching occurs when the teaching is based exclusively on meaning-focus tasks, and the task-supported ... general, with VCDs pupils time-on-task was around 70% of the class-time against 45% of the class-time in case of audiocassettes used. Languages are not fixed but constantl...

Ngày tải lên: 07/11/2012, 14:44

... for Computational Linguistics Lexical surprisal as a general predictor of reading time Irene Fernandez Monsalve, Stefan L. Frank and Gabriella Vigliocco Division of Psychology and Language Sciences University ... psychological accu- racy of each model (χ 2 (2) values) plotted against its linguistic accuracy (i.e., its quality as a lan- guage model, measured by the negati...

Ngày tải lên: 08/03/2014, 21:20

... transitions. 10652 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0802721105 Vinh et al. Silicon as a model ion trap: Time domain measurements of donor Rydberg states N. Q. Vinh*, P. T. Greenland † , K. Litvinenko ‡ , ... scales 10–100 times faster than what is usual in atoms. Our time- domain dat a show directly that population decay ef fects are the dominant contributio...

Ngày tải lên: 16/03/2014, 15:30

... (5Â-TATA CCATGG GCTTAAGTCCTGAAAATTCTCCAG-3Â) and oBQ147 (5Â-AAA CTCGAGCCGGCCCTCAATTTTGACCTCCTGC AATGTGAAATAGAACG-3Â), and cloned between the NcoI and XhoI sites into pET2 8a( +), providing a His-tag ... we aimed at the identification of a chromophore that is incor- porated in vivo into cyanobacterial phytochrome B within the cyanobacte- rial cell. The approach was based on t...

Ngày tải lên: 30/03/2014, 08:20

... hepatic cancer, colon cancer and lung cancer. Immunostaining of prostate cancer tissue with antibodies against AMACR and PSAFigure 2 Immunostaining of prostate cancer tissue with antibodies against ... mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) . In contrast, t...

Ngày tải lên: 18/06/2014, 15:20

... 102:908-915. doi:10.1186/1479-5876-8-112 Cite this article as: Cammarota et al.: The tumor microenvironment of colorectal cancer: stromal TLR-4 expression as a potential prognostic marker. Journal of Translational Medicine 2010 ... Open Access The tumor microenvironment of colorectal cancer: stromal TLR-4 expression as a potential prognostic...

Ngày tải lên: 18/06/2014, 16:20

... may indicate patients in metastasis stage. Analysis of results demonstrated that in part of the studied blood samples of cancer patients activity of CGB and GNRH1 wasonthesamelevelasincontrolgroup. There ... method of tumor cells metastatic spread detection in patients with gynecological malignances. Journal of Translational Medicine 2011 9:130. A...

Ngày tải lên: 18/06/2014, 22:20

... performance We collaborated with K [36], a promising musician, to prove the capabilities of the robot arm when used as a compliant tangible music interface. Together with the artist, we created a ... move towards a virtual attractor in 3D Cartesian space as if its dynamics was equivalent to a virtual mass concentrated in its end-effector and attached by a virtual sp...

Ngày tải lên: 20/06/2014, 20:20

... Email addresses: Music expression with a robot manipulator used as a bidirectional tangible interface Victor Zappi ∗ , Antonio Pistillo, Sylvain Calinon, Andrea Brogni and Darwin Caldwell Department ... has been extended with music mappings, as explained later in this section. The robot is used as a haptic interface to create low frequency oscillators and a...

Ngày tải lên: 21/06/2014, 17:20

... activation and aggrecan and collagen release. Materials and methods Cartilage degradation assay Bovine nasal cartilage was cultured as previously described [20]. Briefly, bovine nasal septum cartilage ... ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α 2 M GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCC...

Ngày tải lên: 09/08/2014, 08:22

... Veterinaria Scandinavica Open Access Research Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in ... in canine mammary gland cancer Renata A Sobral 1 , Suzana T Honda 1 , Maria Lucia H Katayama 1 , Helena Brentani 2 , M Mitzi Brentani 1...

Ngày tải lên: 12/08/2014, 18:22

... 5' primer used was 5'- ATCCAAGACGGAATTCACGCCGCAGGAGAAA- GAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAG- GAAGTTGGCAG-3'; ... Access Research APOBEC3G- UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication Lin Li 1,4 , Dong Liang 1 ,...

Ngày tải lên: 13/08/2014, 05:21

... the mechanical angular speed is eliminated by adding a feed-forward term to the output of the q-axis controller [2], [5]. The rotor mechanical angular speed is treated as an scheduling parameter ... changing of the rotor angular speed. In that sense, the rotor angular speed can be adopted as a gain-scheduling parameter. Tài liệu t...

Ngày tải lên: 26/10/2014, 14:39

... Just as a time expression Just is one of the commonest words in English. It has many uses. Just as a time expression Just can be a time expression. In this case, it is mainly used ... called. I just received a call from your Dad. She just left. I just finished the report. As a time expression, just means recently. Just can also mean immediately...

Ngày tải lên: 11/07/2015, 19:52