... - Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge - Naohiro KISHIDA*, Atsushi KONO**, Yutaka YAMASHITA***, ... NaHCO 3 , and the water temperature was maintained at 22 ± 2°C. Reactor Setup and Operation for the Formation of Aerobic Granular...
Ngày tải lên: 05/09/2013, 10:15
... Ex : brother-in-law => brothers-in-law Passer-by => passers by
Ngày tải lên: 24/12/2013, 19:15
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... 1903 Evidence that the assembly of the yeast cytochrome bc 1 complex involves the formation of a large core structure in the inner mitochondrial membrane Vincenzo Zara 1 , Laura Conte 1 and Bernard ... respiratory chain, the assistance of specific chaperone proteins is also required. The available data indicate that the accessory factor Bc...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure Federica Sinibaldi, Maria C. Piro, Massimo Coletta and Roberto Santucci Dipartimento ... strength of the Met8 0– Fe(III) axial bond] of the salt-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cott...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Oxidation inhibits amyloid fibril formation of transthyretin ppt
... and the kinetics of fibril formation of these oxidized proteins reveal the amino acid inter- actions that are critical in the onset of amyloido- genesis. The rates of amyloid fibril formation for ... (bottom) unoxidized tryptic peptides showing the oxidation of methionine after reaction of V30M TTR with ROS. S. D. Maleknia et al. Oxidation inhibits amyloid fib...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrine Rev 15, 439–461. K. Komaru et al. Novel aggregate formation of an alkaline phosphatase frame-shift mutant FEBS ... Inactiva- tion of two mouse alkaline phosphatase genes and establishment of a model of infantile hypophosphatasia. Dev Dyn 208, 432–446. K. Komaru et...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â)(Nẳ A, T, G, C) and pyk- back (5Â-CTCTACATGCATTTCAACAATAGGGCCTG TC-3Â) ... enzymes: J l a las ịẳ 0:0123 93:9 a las ị1 e 7: 1a 3:2 las ị0:276, J glucose a las ịẳ 0:693 83:3 a las ị1 e 6a 2:1 las ị33:2 (User dened), J lactate a las ịẳ0...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu The Formation of Christendom, Volume VI pdf
... of another kind generating also an empire of another sort. The raid of Genseric in the year 455 is the first of three hundred years of warfare carried on from the time of the Vandal through the ... in the place of the country of the Romans,"[6] and there he was to find his own resting-place. The church was built to guard the emblems of the two ca...
Ngày tải lên: 21/02/2014, 11:20
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... acid is located in the insert within the catalytic domain, close to the catalytic His264, and the proximity to the active site may explain the effect of oligomerization on enzyme activity. Even ... though the exact mechanism for complex formation and activation of the enzyme remains to be determined, it can be concluded that the insert within the...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... schematic example of how protein aggregation and amy- loid fibril formation prediction software might be used for fine-tun- ing and control of protein solubility in bacterial IBs is shown. (A) The amino ... bias specific to the available data, the authors of waltz Table 1. Protein aggregation and amyloid fibril formation prediction servers (URLs)...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Lysophosphatidylcholine modulates fibril formation of amyloid beta peptide doc
... Lysophosphatidylcholine modulates fibril formation of amyloid beta peptide Abdullah Md. Sheikh and Atsushi Nagai Department of Laboratory Medicine, Shimane University School of Medicine, ... of transmembrane amyloid precursor protein [1]. Bio- chemical analysis of the Ab peptides isolated from AD Keywords Alzheimer’s disease; amyloid beta peptide; fibril fo...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Formation of highly toxic soluble amyloid beta oligomers by the molecular chaperone prefoldin pptx
... and then M. Sakono et al. Formation of amyloid beta oligomers by prefoldin FEBS Journal 275 (2008) 59825993 ê 2008 The Authors Journal compilation ê 2008 FEBS 5989 Formation of highly toxic soluble ... of soluble Ab oligomers formed in the pres- ence of PFD. Samples of Ab oligomers formed in the presence of PFD (Ab ⁄ PFD), Ab fibrils formed in the...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: New application of firefly luciferase ) it can catalyze the enantioselective thioester formation of 2-arylpropanoic acid docx
... on the conversion (c) and ee of the recovered acid (ee(s )) according to the equation: E ẳ ln[(1 ) c)(1 ) ee(s )) ] ln[(1 ) c)(1 + ee(s )) ] [27]. Entry Conversion ( %) Recovered acid (% yield) ee ( %) ... al. New application of firefly luciferase FEBS Journal 274 (200 7) 38773885 ê 2007 The Authors Journal compilation ê 2007 FEBS 3885 New ap...
Ngày tải lên: 07/03/2014, 10:20
Formation of questions and negatives
... Formation of questions and negatives Change the following affirmative sentences into negatives and questions. An example is given below: Jane drinks coffee in the morning. ... below: Jane drinks coffee in the morning. (Assertive) Jane does not drink coffee in the morning. (Negative) Does Jane drink coffee in the morning? Exercise 1. Martha lives with her sister. 2. Jame...
Ngày tải lên: 10/07/2015, 20:46
Formation of negatives
... play football in his youth. 4. We had our roof blown off in the storm. a) We didn’t have our roof blown off in the storm. b) We hadn’t our roof blown off in the storm. 5. He had an accident last ... Formation of negatives Each positive sentence given below is followed by two forms of its negative. Put a tick mark against the correct form ... other one is wrong. 1. We had a meeting of...
Ngày tải lên: 11/07/2015, 13:42