proteins are powerfull

... 2010 The Authors Journal compilation ê 2010 FEBS Minor capsid proteins of mouse polyomavirus are inducers of apoptosis when produced individually but are only moderate contributors to cell death ... that the minor capsid pro- teins are not the sole or even the main inducers of apoptosis in the infection process and are dispe...

Ngày tải lên: 16/02/2014, 09:20

... ê 2007 FEBS Calcium-binding to lens bB2- and bA3-crystallins suggests that all b-crystallins are calcium-binding proteins Maroor K. Jobby and Yogendra Sharma Centre for Cellular and Molecular ... 2007) doi:10.1111/j.1742-4658.2007.05941.x Crystallins are the major proteins of a mammalian eye lens. The topologic- ally similar eye lens proteins, b- and c...

Ngày tải lên: 18/02/2014, 16:20

... FEBS Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant Wance ... 200 10 1 10 2 FL2-H 10 3 10 4 25Q +NAC 72Q 72Q+NAC 10 3Q 10 3Q+NAC 04080 Counts 12 0 16 0 200 10 0 10 1 10 2 FL2-H 10 3 10...

Ngày tải lên: 19/02/2014, 06:20

... for Las-AFP is identical to the isolated plasma proteins [11]. Dusky snailfish also express the same type I AFP in skin tissue that is circulating in their blood (Table 1). Expression of snailfish type I ... frozen in liquid nitrogen and stored at )70 °C. Skin library construction and screening Total RNA from Atlantic snailfish skin tissue was isolated using T...

Ngày tải lên: 20/02/2014, 02:22

... Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities Ste ´ phane ... study investigated the enzymatic function of two putative plant GPXs, GPXle1 from Lycopersicon esculentum and GPXha2 from Helianthus...

Ngày tải lên: 08/03/2014, 22:20

... compilation ê 2010 FEBS 2741 LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis Alexandra Deli 1 , Dimitrios ... Neighbor joining tree for 929 LmbE proteins. Bacillus cereus proteins and pro- teins of known function are indicated. A. Deli et al. L...

Ngày tải lên: 15/03/2014, 11:20

... Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku- 80 subunit is necessary for basal transcription of the WD gene Won ... Immunoblot analysis and EMSAs showed that the MREa-binding proteins are immunologically rela- ted to the Ku prot...

Ngày tải lên: 17/03/2014, 23:20

... show minima at around 208 and 222 nm, a crossover in sign at 202 nm, and a maximum at 193 nm, which are typical characteristics of a protein largely dominated by a- helix. From the molecular ellipticity ... temperature, are different from a protein that has evolved to be hyperthermostable as a consequence of the adaptation to a factor other than elevated temperature....

Ngày tải lên: 30/03/2014, 13:20

... of BTG/Tob family proteins are situated on the conserved N-terminal BTG/Tob homology domains, because BTG1, BTG2, Tob, and Tob2 proteins are all degraded by the ubiquitin–proteasome system and the ... levels of BTG1 and BTG2 mRNAs increase in the early G1 phase of the cell cycle [4,5] and that BTG/Tob family proteins are involved in G1 arrest [7,11,...

Ngày tải lên: 31/03/2014, 21:21

... computational analyses suggest that GP64 superfamily proteins are class III penetrenes. Each of the major features common to class III fusion proteins are present in THOV GP and AcMNPV GP64, including ... GP share significant sequence similarity with baculovirus GP64, and are included in the GP64 superfamily [30,31]. Here, we present the results of prote...

Ngày tải lên: 20/06/2014, 01:20

... of pcDNA3.1(+)-FLAG- tagged expression vector [43]. Primers for NS3/4A; 5'- AAGGGGGGATCCACCATG GCGCCCATCACGGCG- TACGCCCAGCAG-3', 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', ... 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT- TCCAGAA...

Ngày tải lên: 20/06/2014, 01:20

... immune sys- tem is further amplified by the results of the analysis of MHC II T cell epitopes using the ProPred server shown in Fig. 5b. Here we can see that the extremely disordered regions of the virus ... extremely disordered pro- teins. Thus X-ray studies of extremely disordered proteins tend either to focus on the ordered domains of the proteins that c...

Ngày tải lên: 09/08/2014, 07:20

... not for citation purposes) Vol 11 No 2 Research article Serum levels of soluble receptor for advanced glycation end products and of S100 proteins are associated with inflammatory, autoantibody, ... TE: Binding of receptor for advanced glycation end products (RAGE) lig- ands is not sufficient to induce inflammatory signals: lack of activity...

Ngày tải lên: 09/08/2014, 13:22

... 10:43 http://www.biomedcentral.com/1471-2229/10/43 Page 4 of 15 RESEA R C H ARTIC L E Open Access Small chloroplast-targeted DnaJ proteins are involved in optimization of photosynthetic reactions in Arabidopsis thaliana Kun-Ming Chen 2 , ... to distinguish the individual roles of these DnaJ proteins in co-chaperone/chaperone cohort. Neverthe- less, in ge...

Ngày tải lên: 12/08/2014, 03:21

... Rondeau Proteins Are Powerful Proteins Are Powerful Books in this series: The Food Pyramid Fruits Are Fun Grains Are Good Milk Is Magnificent Proteins Are Powerful Vegetables Are Vital 9 ... Data Rondeau, Amanda, 1974- Proteins are powerful / Amanda Rondeau. p. cm. (What should I eat?) Summary: A simple introduction to the protein food group and why proteins are impo...

Ngày tải lên: 07/07/2015, 22:39