Introgression of the Saltol into AS996, the elite variety of Vietnam, using Marker Assisted Backcrossing

... components by use of the inverse Diels Alder technology. The high chemical stability and the ease of synthesis qualify these polyamide building blocks as favourites for intracellular delivery and ... S S c c i i e e n n c c e e s s 2011; 8(5):387-396 Research Paper Enhancement of the Click Chemistry for the Inverse Diels Alder Technology by...

Ngày tải lên: 25/10/2012, 11:00

... sausages, and pork increases the inci- dence of toxoplasmosis. The Inflammatory and Autoimmune Ocular Diseases Service of Parma University Hospital is a reference Centre for the Parma area. Therefore, ... 6(3):11 8-1 19 â Ivyspring International Publisher. All rights reserved Short Communication Incidence of Ocular Zoonoses referred to the Infl...

Ngày tải lên: 03/11/2012, 11:11

... determine the effect of the number of the ventilation pipes on the composting rate, an attempt was made to correlate the composting rate with the number of the perforated pipes for air supply in the ... effective for the passive aeration by the natural convection. 2) The composting rate was increased in increasing in the numb...

Ngày tải lên: 05/09/2013, 08:40

... Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time. ... ex- postmaster of Bath, and Messrs. S.I. Toleman and G.E. Chambers, ex-assistant Superintendents of the Bristol Post Of...

Ngày tải lên: 17/02/2014, 02:20

... using IMAGEQUANT software, and depurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressing values as a percentage. Reassociation and quantification of ... quantitative activity assays of these RTA variants, was not achieved. To assess whether substitution at Asn78 with Ser changed the catalytic activity of RTA, t...

Ngày tải lên: 19/02/2014, 12:20

... The Majors of Golf Complete Results of The Open, the U.S. Open, the PGA Championship and the Masters, 1860–2008 MORGAN G. BRENNER Volume 1 (Introduction; Abbreviations; The Open; U.S. ... 3 Part I. The Tournaments 7 The Open Championship 9 U.S. Open Championship 200 ã Volume 2 ã Professional Golfers Association of America Championship 39...

Ngày tải lên: 22/02/2014, 08:20

... distributed from the land to the 25m water depth 2) Thickness of the Holocene deposits varies from 40 to 55 m, consist of silty sand and clay, coming from the Mekong river. A depositional balance in ... [11,12]. The elevation of these sand ridges is about 2-7m, their width varies from 100 to 3000m. They distributed parallel to the shore in th...

Ngày tải lên: 05/03/2014, 16:20

... 5Â-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 Â (forward, the mutagenesis codon underlined) and 5Â-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3Â (reverse). The pET151 HP1287 plasmid was ... from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity Nicola Barison 1,2 , Laura Cendron 1,2 , Alberto Trento...

Ngày tải lên: 16/03/2014, 00:20

... 5.0 RNase A 58.8 423 4.1 4732 C. Ercole et al.(Eur. J. Biochem. 270) Ó FEBS 2003 Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase Carmine ... suggest that the structural determinants that control the exchange of N-terminal arms in BS -RNase may not be located within the hi...

Ngày tải lên: 16/03/2014, 23:20

... of the anesthetics benzyl alcohol, propofol, chlo- roform and diethyl ether reversed the resistance by acceleration of the passive transport of the drug or dye across the plasma membrane. At these ... the amount of drug incorporated in the plasma membranes [31], it seems that the anes- thetics accelerate the permeation by enhancing the drug...

Ngày tải lên: 30/03/2014, 04:20

... Genetics of Wood Production, Springer-Verlag, Berlin, 1995, 337 p. Original article Genetic control of stiffness of standing Douglas fir; from the standing stem to the standardised ... 5). Therefore, the modulomètre is able to rank trees and genetic units for a trait related to the MOE of the wood of the first 2 m of...

Ngày tải lên: 08/08/2014, 14:21

... line and the profile (Nb). Original article Genetic control of stiffness of standing Douglas fir; from the standing stem to the standardised wood sample, relationships between ... 0.001, whatever the study level): Lhi, Dcu and Ene. Thus two of them, Lhi and Dcu, were excluded from the study of the modelling of the...

Ngày tải lên: 08/08/2014, 14:21

... http://genomebiology.com/2010/11/2/106 Page 2 of 3 The pea aphid life cycle e ecology, physiology and evolution of the hemipteran insect pea aphid (Acyrthosiphon pisum) has been well studied because of its ... published in this issue of Genome Biology [2]. e genome of the pea aphid is the first to be sequenced of the hemimetabolous group of insects, charac...

Ngày tải lên: 09/08/2014, 20:21

... VNU Journal of Science, Natural Sciences and Technology 28 (2012) 37-46 37 Introgression of the Saltol into AS996, the elite variety of Vietnam, using Marker Assisted Backcrossing Luu ... scoring of the gel pictures. 2.4. Data analyses The molecular weights of the different alleles were scored using Alpha Ease Fc 5.0 software. The marker...

Ngày tải lên: 26/06/2015, 09:15