KẾT CẤU MỚI DEVELOPMENT OF THE NEW WEMBLEY STADIUM ROOF

... up the main North South T3 and T4 trusses These trusses span to the South edge of the bowl and are the main elements which support the whole of the Southern roof area THE ROOF PLATE The roof ... trusses span to the Southern edge of the bowl T3 spans 155m and T4 129m These trusses, together with the edge T5 trusses support the main Southern roof and carry...

Ngày tải lên: 09/06/2015, 17:24

... significantly to the cost of the system The actual design therefore is a trade off between the capacity of the jacks used and the sophistication of the equipment On the Dome it was found that the most ... CLAMPS The design of the clamps, which attached to the ends of the permanent cables in order to transfer the pulling force, was an important issue on...

Ngày tải lên: 09/06/2015, 17:23

... a market then the reasons favouring one rather than the other are probably marginal Of course, if a group of open air dining spaces were under a wide span canopy, radiant heaters to each space ... Formation of a layer of hot gases Fig The thermal equilibrium of any part of the world is affected by ventilation We not particularly think of the hottest parts...

Ngày tải lên: 09/06/2015, 17:22

... of the roof the wind flow conditions would be close to potential flow where the wind would sweep the roof clear of snow The provision of building services and the management of an enclosure of ... PRINCIPLES OF THE D O M E ROOF STRUCTURE The structural concept for the roof is based on the innovatory principle of using straight tensioned cables and fla...

Ngày tải lên: 09/06/2015, 17:22

... with the revitalised South Bank and the international terminal at Waterloo Station Fig 11 Fig 280 THE DESIGN OF THE ROOFS The Gateshead Roof The starting point for the Gateshead roof was to design ... centre of each side of the roof, behind the porticoes, the lateral spreading movement of the roof is one directional, normal to the line of the...

Ngày tải lên: 09/06/2015, 17:25

... chiếu 10 Fountain: vòi nước ; be springing: xịt nước = be spraying ; pool: hồ nước 11 Stream: dòng suối 12 Be flowing: chảy (nước) NEW TOEIC TEST SERIES WATER (liên quan NƯỚC) 13 14 15 16 17 18 19 ... (water) Net: lưới NEW TOEIC TEST SERIES See you in the next slide of New TOEIC Test Series! NEW TOEIC TEST SERIES TOEIC Thầy Tuấn Anh www.facebook.com/izz...

Ngày tải lên: 07/08/2015, 06:09

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the ... RTQ -PCR assay These findings suggest that the ultra sensitive RTQ -PCR assay is equally reliable as the Figure Comparison of the HBV-DNA values estimated using COBAS TaqM...

Ngày tải lên: 12/08/2014, 04:20

... have also shed light on fundamentals of performance: In terms of the 'absolutes' of measurement, illustrations on a logarithmic scale relate the basic forms of stability of everything from mountains ... Exhibition in 1988 (fig 27) Fig 26 'Inversion' of the tension eye for Montreal and the I.L (fig 28) led to the development of the compression forms for the new below-ground...

Ngày tải lên: 09/06/2015, 17:20

... display of behaviour (Fig 25), form and patterning (Fig 30), and stress distributions (Figs 35 and 36), are clearly useful aids to guide the design process The display and simple storage of stress ... between form, patterning, design loads and stress distributions that the use of CAD procedures is an essential feature in both the conceptual and developed design stag...

Ngày tải lên: 09/06/2015, 17:21

... of the glass house at the start of the nineteenth century, the technologies adopted at Eden will be part of a major step in the development of greenhouse architecture at the beginning of the ... sheets of glass In collaboration with the engineer Anthony Hunt Associates we developed the steel and glass roof that took on the sinuous shape of the tracks below It was...

Ngày tải lên: 09/06/2015, 17:21

... constructing the Brabazon aircraft, the largest aircraft in the world at the time The building's clear height (23m) was determined by the height of the Brabazon tailfin and its clear internal span, ... The client embarked on a significant construction contract, comprising the removal of the existing heating system, including the steam pipework installation, asbestos i...

Ngày tải lên: 09/06/2015, 17:22

... space-station look to the structure, they were to hold part of the exhibition However, space constraints meant that the plant had to be moved outside of the Dome The team liked the idea of using the now defunct ... concept diagram for the service pods THE EXTERNAL SERVICE PODS Included in all views of the exhibition since they first entered the public domain, the cyl...

Ngày tải lên: 09/06/2015, 17:22

... suspended from the roof than would otherwise be necessary There are two rings of walkways running around the stadium to access these The first is located back from the edge of the opening and the second ... by the back of the stands and at the other by the Primary/Secondary trusses which surround the opening To achieve good sight lines the trusses reduce from 4.3 metre...

Ngày tải lên: 09/06/2015, 17:24

... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... Research Objectives The primary objective of the present study was to develop a new Elastic Path Controller for the Collaborative Wheelchair Ass...

Ngày tải lên: 11/09/2015, 09:59