0
  1. Trang chủ >
  2. Thạc sĩ - Cao học >
  3. Sư phạm >

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

A study on linguistic features of word groups denoting human inner feeling in published diaries (english versus vietnamese)

A study on linguistic features of word groups denoting human inner feeling in published diaries (english versus vietnamese)

... Denoting Head N+Adj+Pron Nominal groups HeadN+Adj(+Prep)+NNG Human Inner Feelings in Published Diaries HeadN+AG+Prep+Pron 4.2.1.1 Word Group "X+Head+Ø" Head V+Adj/AG/NG Human Inner Feelings in ... Conj+HeadV2+Pron+PG Adv+Head V+PG GROUPS Aux+Head Adj+PG Adv+Head Adj+AG PUBLISHED Adv+Head Adj+N VIETNAMESE Adv+Adv+Head 4.3.1 Conceptual Metaphorical Features of Word Groups Adj+Pron+Adv +Pron Denoting ... categories into syntactic and conceptual metaphoric features Accordingly, the data was sorted into categories of inner feelings All - Making a comparison and contrast to draw the similarities and of...
  • 13
  • 737
  • 1
A study on cognitive metaphors of negative emotions in english and vietnamese

A study on cognitive metaphors of negative emotions in english and vietnamese

... stories and novels in English and Vietnamese in paper books, ebooks and online stories 3.3 DATA ANALYSIS On the basis of 960 metaphorical expressions of ANGER, SADNESS and FEAR, data analysis is carried ... fear in Vietnamese Besides, some metaphors of negative emotions popular in English cannot be found in Vietnamese data They include the conceptualization of ANGER and SADNESS as AN OPPONENT and ... expressions - investigating cognitive metaphors of three negative emotions ANGER, SADNESS and FEAR in English and Vietnamese based on the theory of cognitive semantics - discovering and explaining the...
  • 13
  • 1,192
  • 6
A study on linguistic features of english competition law and vietnamese competition law

A study on linguistic features of english competition law and vietnamese competition law

... English Competition law and Vietnamese Competition law A study on linguistic features of other laws (press -law, which require knowledge of not only vocabulary but of grammar as copyright law, foreign ... Syntactic Features contains a large number of technical terms (terms of art), which have 2.2.3.1 Nominalization acquired a specific and accurate law meaning through centuries of Nominalization characterizes ... reasons, I recognize that exploring into in terms of lexical features and syntactic features in English language of competition law, therefore, is very essential Language is competition law and...
  • 13
  • 807
  • 0
A study on an argumentative essay

A study on an argumentative essay

... establishes a logical chain of reasoning, refutes opposing arguments, and accommodates the views of an audience Chapter two: An insight into an argumentative essay Organization: An argumentative ... something or contrasts something A comparison essay is an essay which emphasizes the similarities, and a contrast essay is an essay which emphasizes the differences We use comparison and contrast thinking ... recorded as far away as Good detail Eastern Europe, Scandinavia, and even Japan Human error was Are these the only mistakes that have happened? responsible for power station accidents in Kola, Russia...
  • 65
  • 270
  • 1
A STUDY ON EMOTIONAL CONNOTATION OF ENGLISH CONVERSION

A STUDY ON EMOTIONAL CONNOTATION OF ENGLISH CONVERSION

... definition, classification, characteristic features and phenomena of conversion Chapter II: The analysis on emotional connotation of conversion in English They are neutral, positive and negative connotation ... want to find out the best answer That is the reason why I choose the research entitled “ A study on the emotional connotation of conversion Aims of the study As I mention above, conversion has ... further study on emotional connotation of conversion is also provided in this part 14 PART II DEVELOPMENT 15 CHAPTER I THEORETICAL BACKOUND I Conversion I.1.Definitions of conversion “ Conversion...
  • 46
  • 447
  • 0
a study on some difficulties of translating business corespondence

a study on some difficulties of translating business corespondence

... nớc International Abbreviation International Abbreviation is a group of letter standing for a phrase of words These international abbreviations are used as official economic terms They are used ... some difficulties of translating business corespondence qualifications of the candidate, which are suitable for the position of Regional Manager Finally, no grammar or punctuation errors can be ... Sample Translation 73 Nguyễn Thuý Vân - FA10_99 - HUFS iii A study on some difficulties of translating business corespondence Acknowledgements The graduation paper named A study on...
  • 75
  • 1,614
  • 11
Tài liệu tiếng anh tham khảo impact of stress on employees job performance a study on banking sector of pakistan

Tài liệu tiếng anh tham khảo impact of stress on employees job performance a study on banking sector of pakistan

... is also a reason of concern The study was conducted only in industry that was banking sector and the impact job stress on job performance was measured only in one sector, if we want to generalize ... the job stress and job performance of employees of banking sector in Pakistan As per hypothesis job stress had a negative relation with job performance that when stress occurs it effects the performance ... The average respondent was 39 years of age, having graduate and postgraduate qualifications HYPOTHESIS: Job stress is negatively associated to job performance of employees 3.1 Job Related Stress...
  • 5
  • 613
  • 1
Báo cáo toán học:

Báo cáo toán học: "A note on an identity of Andrews" docx

... in: B E Sagan, R P Stanley (Eds.), Mathematical Essays in honor of Gian-Carlo Rota, Birkauser, Basel 1998, pp 111-129 [3] Z G Liu, Some operator identities and q-series transformation formulas, ... (13) The proof is completed References [1] G E Andrews, Ramanujan’s ”lost” notebook I Partial θ-functions, Adv in Math 41 (1981), 137-172 [2] W Y C Chen - Z G Liu, Parameter augmentation for basic ... 2 The proof of the Theorem The q-difference operator and the q-shift operator η are defined by Dq {f (a)} = (f (a) − f (aq)) a and η{f (a)} = f (aq), respectively In [2] Chen and Liu construct...
  • 3
  • 266
  • 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

... in the body The body is the largest part of a presentation in which the presenters place their arguments and ideas, their substantiation and examples, and their proofs and illustrations The goal ... analysis The preparation for a presentation must include gathering information about the audience and their needs It is critical that preparation efforts include some amount of audience analysis As ... provide them with model presentations, including necessary vocabulary and functional language for an effective presentation or introduce the organization, format and criteria of a presentation in English...
  • 50
  • 454
  • 2
A study on sector index of stock market proposal for development of FPTS sector index

A study on sector index of stock market proposal for development of FPTS sector index

... = adjusted base date market capitalization of the index at time (t) 31 A study on sector index of stock market - proposal for development of FPTS sector index 2.1.6 Comparison and conclusion of ... institutions 34 A study on sector index of stock market - proposal for development of FPTS sector index The both are market capitalization weighted indices VN -Index has base value 100 and the base date ... 19 A study on sector index of stock market - proposal for development of FPTS sector index Membership requirements include:  Market Capitalization: Stocks with a float-adjusted market capitalization...
  • 77
  • 732
  • 0
A Study on Sentence Errors of the English Compositions of the Second Year Students at Diplomatic Academy of Vietnam = Nghiên cứu lỗi về câu trong các bài viết c

A Study on Sentence Errors of the English Compositions of the Second Year Students at Diplomatic Academy of Vietnam = Nghiên cứu lỗi về câu trong các bài viết c

... identification of errors, 2) description of errors, and 3) explanation of errors Research questions What are sentence errors made by the second year students at Diplomatic Academy of Vietnam? What are ... are the causes of the sentence errors made by the second year students at Diplomatic Academy of Vietnam? The significance The study was supposed to have a great deal of significance The first one ... ENGLISH COMPOSITIONS OF THE SECOND YEAR STUDENTS AT DIPLOMATIC ACADEMY OF VIETNAM (NGHIÊN C U LỖI VỀ C U TRONG C C BÀI VIẾT C A SINH VIÊN NĂM THỨ HAI H C VIỆN NGOẠI GIAO VIỆT NAM) M .A Minor ProgrammeThesis...
  • 62
  • 716
  • 0
A study on teachers’use of Vietnamese in English lessons at An Duong high school, Hai Phong = Nghiên cứu về việc sử dụng tiếng Việt của giáo viên trong các giờ

A study on teachers’use of Vietnamese in English lessons at An Duong high school, Hai Phong = Nghiên cứu về việc sử dụng tiếng Việt của giáo viên trong các giờ

... Teaching and learning grammar London : Longman 13 Harmer, J ( 1997) The practice of English language teaching London : Longman 14 Haycraft, J ( 1978) An introduction to English language teaching ... Vietnamese All in all, I think that using some Vietnamese in the classroom is necessary and the advantages of doing so outweigh any disadvantages In this teacher‘s opinion, it is an advantage ... Summary of the study The result of this study revealed that the use of Vietnamese was an unavoidable phenomenon in many Vietnamese high schools in general and at An Duong high school in particular...
  • 53
  • 1,057
  • 1
A study on premature segregation of unreplicated chromosomes 1

A study on premature segregation of unreplicated chromosomes 1

... a few examples of premature spindle elongation, precocious chromosome segregation and conditions that lead to them 48 1. 5 Premature spindle elongation and segregation of unreplicated chromosomes ... APCCdc20 activation at anaphase onset followed by APCCdh1 at the end of mitosis through G1 1. 3.3.2 Regulation of anaphase by APC The anaphase promoting complex (APC) was named for its best-known and ... usually act as a signal for proteasome mediated degradation (Nandi et al 2006) Polyubiquitylation at Lys63 may act as a signal for DNA repair but not degradation (Weissman 20 01) Moreover, monoubiquitination...
  • 64
  • 287
  • 0
A study on premature segregation of unreplicated chromosomes 2

A study on premature segregation of unreplicated chromosomes 2

... THOSE OF THE HA PLASMID OUS1183 Forward oligo to tag the endogenous kip1 by one step PCR: US Lab 50 BP JUST BEFORE THE STOP CODON 5'AGAAGAAACTGAAAATAATGACATACTGCAAAA TAAAAAACTTCATCAATTTCATCTCCGGTTCTGCTG ... codon UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS1166 5’TACTTTGTTTTTATTAACCACTAGTTTGAATAT3’ US Lab ATATTCGACTGAAAGGCAATATCAA CGTCGACCTCGAGGCCAGAAGACTAAGAGG 3' UNDERLINED SEQUENCES ARE ... OUS2815 5’ATTGATGAAGAAGCTGATGA3’ US Lab to be used OUS2814 to check 3' tagging of Ase1 by plasmid pUS2170 OUS1545 5’GGA AAA ATG AGC AAG TTT CGA AAT TGA ATG US Lab GAT TCT CCT TTA CAG ATA TTC GGA...
  • 25
  • 284
  • 0

Xem thêm

Từ khóa: an example of a study using the case study research designgive an example of a conflict of interest in sciencewhat is an example of a rainforest food chainan example of a difficult situation interview questionlistening carefully to a song the first time you hear it is an example ofwhat is an example of interaction between biotic and abiotic components of an ecosystemgive an example of dealing with a challenging situationi need an example of a letter of intent for a job within my companyan example of a conflict of interest in sciencewhat is an example of a food chain in the tropical rainforesta study on prepositions of direction and some errors made by vietnamese learnersa study on syntactic semantic and pragmatic features of exaggeration in english and vietnamesea study on improving speaking skill of the first year english majora study on pronunciation errors made by fourth year students of english at vinh university and suggested solutionsa study on the translation of english important diplomatic terms in diplomacy documentsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP