Community in preservation and promotion of historical, cultural values of Coloa relic, Hanoi

ARSENIC POLLUTION IN SOIL AND GROUNDWATER OF BANGLADESH

ARSENIC POLLUTION IN SOIL AND GROUNDWATER OF BANGLADESH

... In Groundwater Of Bangladesh Field experience and available data shows that both soil and under groundwater of a vast area of Bangladesh has been threatened with arsenic contamination affecting ... Preliminary Results of Groundwater investigation in Arsenic affected areas in Bangladesh A Report Prepared by RGAG Japan RGAG(1999) Arsenic contamination of...

Ngày tải lên: 05/09/2013, 08:40

7 361 0
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable – In grid networks (with high band...

Ngày tải lên: 15/01/2014, 15:59

32 581 0
Tài liệu Sounding the Event- Escapades in dialogue and matters of art, nature and time doc

Tài liệu Sounding the Event- Escapades in dialogue and matters of art, nature and time doc

... restless times from which comes background noise? Yes, how is such an image to greet the murmuring and the crackling and the tinkling and the crying and the sighing and rumbling and the roaring of ... birds and tree There was the agitation, the vacillation, the vibration There was, also, the movement of the time that made the time of day, the...

Ngày tải lên: 17/01/2014, 01:20

206 499 0
Tài liệu Good practices in planning and management of integrated commercial poultry production in South Asia ppt

Tài liệu Good practices in planning and management of integrated commercial poultry production in South Asia ppt

... Good practices in planning and management of integrated commercial poultry production in South Asia by R Prabakaran Professor of Poultry Science Tamil Nadu Veterinary and Animal Science ... researchers and those involved in development in general Good Practices in Poultry Production in South Asia Chapter Poultry Industry in South...

Ngày tải lên: 21/02/2014, 01:20

98 519 0
Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

... should induce activation of all protein kinases shown to contribute to the neokyotorphin effect Both PKA and CaMK II are known to be activated by Ca2+ influx, in the case of CaMK II activation is ... established as neokyotorphin- effect mediators in L929 cells, are PKA, CaMK II and MAPK Discussion Fig Effect of lM neokyotorphin and 50 lM 8-Br-cAMP in L92...

Ngày tải lên: 07/03/2014, 11:20

11 726 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
fraud and responsibilities of auditor in detecting and preventing of fraud

fraud and responsibilities of auditor in detecting and preventing of fraud

... about the responsibilities of both internal and external auditor in detecting and preventing fraud 2.3.1 Responsibilities of internal auditor Internal auditor plays an important role in fraud detection ... fraud and the responsibilities of auditor in detecting and preventing of fraud Fraud can be considered as most concerning problem of th...

Ngày tải lên: 13/03/2014, 14:20

56 467 1
FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION pptx

FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION pptx

... Movements: Definitions, Data and Method 46 TURKEY, 1980-2000: FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION I Introduction Integration of the developing national ... extend of disassociation of the productive sphere of the domestic economy from its indigenous processes of accumulation and distribution As internationaliza...

Ngày tải lên: 15/03/2014, 19:20

73 449 0
comparing two documentaries one day in september and nanook of the north

comparing two documentaries one day in september and nanook of the north

... pieces are informing One day in September is more developed due to time it was produced The two show a big difference in the development of documentaries but I think Nanook was a very influential ... now and what he was like then In comparison One day in September is a better informing piece than Nanook because it uses more factors to keep the audience in...

Ngày tải lên: 21/03/2014, 21:59

2 421 0
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

... of the diagnosis intervals and initiation of treatment intervals with respect to days One hundred and three patients (50.5%) had delays in diagnosis and 51 patients (25%) had delays in initiation ... Med, 1992; 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural...

Ngày tải lên: 22/03/2014, 18:20

6 467 0
Summary of phd thesis today’s preservation and development of cultural heritage in thua thien hue province

Summary of phd thesis today’s preservation and development of cultural heritage in thua thien hue province

... promotion of cultural heritage in Thua Thien Hue and their reasons Limitations in the preservation and promotion of cultural heritage in Thua Thien Hue Limitations and inadequacies in the preservation ... OF CULTURAL HERITAGE IN THUA THIEN HUE AT PRESENT 3.2.1 Characteristics of cultural heritages in Thua Thien Hue Through th...

Ngày tải lên: 14/07/2014, 13:33

27 508 0
A research to assess community eco-tourism and suggestions of solutions fo sustainable tourism development in Van Don district - Quang Ninh province

A research to assess community eco-tourism and suggestions of solutions fo sustainable tourism development in Van Don district - Quang Ninh province

... study: "A research to assess community eco -tourism and suggestions of solutions for sustainable tourism development in Van Don District, Quang Ninh province" as my master's degree graduation study, ... current tourism activities in Van Don and to further research and build a model community ecotourism towards sustainable developmen...

Ngày tải lên: 16/03/2015, 17:35

122 465 0
Community in preservation and promotion of historical, cultural values of Coloa relic, Hanoi

Community in preservation and promotion of historical, cultural values of Coloa relic, Hanoi

... thức, đời sống tâm linh tinh thần cộng đồng cao Bên cạnh đó, cư dân Cổ Loa sinh sống mảnh đất giàu truyền thống lịch sử, hai lần chọn làm kinh đô, với nét kiến trúc quân thành kinh thành, mang dấu ... thị hóa giúp cho đời sống kinh tế người dân nâng cao Từ đó, nhu cầu khách quan nhà sinh hoạt theo tỉ lệ thuận mà tăng lên Bên cạnh nhà sinh hoạt, nhu cầu buôn bán, kinh doanh dẫn đến việc người...

Ngày tải lên: 16/03/2015, 17:36

204 221 0
w