development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ
A novel interval method for validating state enclosures of the
... based on a two stage approach. First, a proof of existence and uniqueness of the solution of the IVP is performed by calculation of guaranteed a priori enclosures of all reachable states in the ... paper, VALENCIA-IVP, a novel approach for VALidation of state ENClosures using Interval Arithmetic for Initial Value Problems, is presented to determine guar...
Ngày tải lên: 12/01/2014, 22:04
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwat...
Ngày tải lên: 18/02/2014, 17:20
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
... reserved. Review of the Need for a Large -Scale Test Facility for Research on the Effects of Extreme Winds on Structures http://www.nap.edu/catalog/6458.html Review of the Need for a Large- scale Test Facility ... publication as the authoritative version for attribution. Copyright â National Academy of Sciences. All rights reser...
Ngày tải lên: 08/03/2014, 19:20
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... state of the system, which was taken as a reference state for the adjustment of the simplified rate laws and S. Bulik et al. Kinetic hybrid models composed of mechanistic and simplified rate laws FEBS ... designates the type of load parameter varied and the range of variation relative to the normal value of the reference state. The las...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... 2008 The Authors Journal compilation ê 2008 FEBS Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity ... enzyme activity in the skin Yoshiaki Sugimura 1, *, Masayo Hosono 1, *, Miyako Kitamura 1 , Tatsuya Tsuda 2 , Kiyofumi...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx
... rule- based methods are effective to detecting gram- matical errors in the writing of learners of En- glish, it has been pointed out that it is hard to write rules for detecting errors concerning the ... used only for generating training data. They cannot be used to distinguish mass and count nouns in the writing of learners of English for the purpose...
Ngày tải lên: 23/03/2014, 18:20
báo cáo hóa học:" Validation of a patient satisfaction questionnaire for anemia treatment, the PSQ-An" potx
... Central Page 1 of 10 (page number not for citation purposes) Health and Quality of Life Outcomes Open Access Research Validation of a patient satisfaction questionnaire for anemia treatment, the ... spectrum of satisfaction responses. The Patient Satisfaction Questionnaire for Anemia Treat- ment (PSQ-An) is a validated, treatment-specific instru- me...
Ngày tải lên: 20/06/2014, 15:20
báo cáo hóa học:" Research Article Strong Convergence of a New Iterative Method for Infinite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert Spaces" pptx
... Method for In nite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert Spaces Shenghua Wang 1, 2 and Baohua Guo 1, 2 1 National Engineering Laboratory for ... H. Wang, G. Marino, and F. H. Wang, Strong convergence theorems for a generalized equilibrium problem with a relaxed monotone mapping and a...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo toán học: "Further applications of a power series method for pattern avoidance" ppt
... research report TH 94-04. the electronic journal of combinatorics 18 (2011), #P134 7 Further applications of a power series method for pattern avoidance Narad Rampersad ∗ Department of Mathematics ... probabilistic approach to pattern avoidance using the Lov´asz local lemma (see [2, 9]). For pattern avoidance it may even be more powerful than the local lemma in cert...
Ngày tải lên: 08/08/2014, 14:23
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf
... RESEARCH Open Access A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Konstantinos N Fountoulakis 1* , Melina Siamouli 2 , Stamatia ... Inventory. BMC Psychiatry 2003, 3:2. doi:10.1186/1744-859X-10-19 Cite this article as: Fountoulakis et al.: A standardized scoring method for the...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: " The development of a knowledge test of depression and its treatment for patients suffering from non-psychotic depression: a psychometric assessment" ppt
... suffering from non-psychotic depression: a psychometric assessment Adel Gabriel* 1 and Claudio Violato 2 Address: 1 University of Calgary and Calgary Health region, 2000 Pegasus Rd NE, Calgary AB ... Canada and 2 Department Community Health Sciences, Faculty of Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary AB T2N 4N1, Canada Email: Adel Gabriel*...
Ngày tải lên: 11/08/2014, 17:20
provisional standard test method for water-soluble chloride available for corrosion of embedded steel in mortar a
... TEST METHOD FOR WATER-SOLUBLE CHLORIDE 222.1-1 ACI 222.1-96 Provisional Standard Test Method for Water-Soluble Chloride Available for Corrosion of Embedded Steel in Mortar and Concrete Using ... determination of water-soluble chloride in a cement system. * However, some aggregates contain a considerable amount of chloride that is bound...
Ngày tải lên: 24/10/2014, 17:40
homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group
... HOMOMORPHISMS OF THE FUNDAMENTAL GROUP OF A SURFACE INTO PSU(1, 1), AND THE ACTION OF THE MAPPING CLASS GROUP by Panagiota Savva Konstantinou A Dissertation Submitted to the Faculty of the DEPARTMENT ... that we have read the dissertation prepared by Panagiota Savva Konstantinou entitled Homomorphisms of the Fundamental Group of a Sur...
Ngày tải lên: 13/11/2014, 09:14
development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ
... make the WLA an ideal location for verifying the proposed in- situ dynamic liquefaction test method. In- situ liquefaction tests were carried out at three separate locations at the WLA. The tests ... Youd Development of a Direct Test Method for Dynamically Assessing the Liquefaction Resistance of Soils In Situ by Brady Ray Cox, M....
Ngày tải lên: 14/11/2014, 13:09