development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ
A novel interval method for validating state enclosures of the
... based on a two stage approach. First, a proof of existence and uniqueness of the solution of the IVP is performed by calculation of guaranteed a priori enclosures of all reachable states in the ... paper, VALENCIA-IVP, a novel approach for VALidation of state ENClosures using Interval Arithmetic for Initial Value Problems, is presented to determine guaranteed state enclosures. The algorithm ... II-C. Although they are fairly efficient for exactly known initial states and parameters, theyare sometimes insufficient for practical scenarios with uncertain but bounded initial states and parameterswhich...
- 12
- 373
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... using the following primers: LTA-1F, 5Â-CTCGAGATGGATAAAGTTTTAAACAGAG-3Â and LTA-1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCAGGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and ... accessible method toexamine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds. The early mortality...
- 11
- 873
- 0
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
... reserved. Review of the Need for a Large -Scale Test Facility for Research on the Effects of Extreme Winds on Structures http://www.nap.edu/catalog/6458.html Review of the Need for a Large- scale Test Facility ... publication as the authoritative version for attribution.Copyright â National Academy of Sciences. All rights reserved. Review of the Need for a Large -Scale Test Facility for Research on the Effects ... president of the National Academy of Sciences. The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallelorganization of outstanding...
- 49
- 588
- 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... state of the system, which was taken as a referencestate for the adjustment of the simplified rate laws and S. Bulik et al. Kinetic hybrid models composed of mechanistic and simplified rate laws FEBS ... designates the type of load parameter varied and the range of variation relative to the normalvalue of the reference state. The last four columns show the percentage of the total variation range of the ... the other than with the other simplified rate laws. Table 2. Differences between simplified and detailed rate laws. The differences between simplified and detailed rate laws for the individual reactions...
- 15
- 456
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... 2008 The Authors Journal compilation ê 2008 FEBS Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity ... enzyme activity in the skin Yoshiaki Sugimura 1, *, Masayo Hosono 1, *, Miyako Kitamura 1 , Tatsuya Tsuda2, KiyofumiYamanishi2, Masatoshi Maki 1 and Kiyotaka Hitomi 1 1 Department of Applied ... indicated that the cross-linking reaction was catalyzed specifically byTGase 1. To further evaluate the specificity of the assay for TGase 1, skin sections from a TGase 1 knockout mouse were also examined....
- 11
- 449
- 1
Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx
... rule-based methods are effective to detecting gram-matical errors in the writing of learners of En-glish, it has been pointed out that it is hard towrite rules for detecting errors concerning the ... used only for generating training data. They cannot be used todistinguish mass and count nouns in the writing of learners of English for the purpose of detecting 1According to experiments we ... taken into account in this pa-per, the feedback corpus contains further useful in- formation. For example, we can obtain trainingdata consisting of instances of errors by compar-ing the feedback...
- 8
- 502
- 0
báo cáo hóa học:" Validation of a patient satisfaction questionnaire for anemia treatment, the PSQ-An" potx
... CentralPage 1 of 10(page number not for citation purposes)Health and Quality of Life OutcomesOpen AccessResearch Validation of a patient satisfaction questionnaire for anemia treatment, the ... spectrum of satisfaction responses. The Patient Satisfaction Questionnaire for Anemia Treat-ment (PSQ-An) is a validated, treatment-specific instru-ment for measuring satisfaction with anemia treatment for ... high prevalence of anemia and the growing recognition of treating anemia incancer patients, there is no assessment tool for evaluatingcancer patients' satisfaction with anemia treatment.Defined...
- 10
- 410
- 0
báo cáo hóa học:" Research Article Strong Convergence of a New Iterative Method for Infinite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert Spaces" pptx
... Method for In nite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert SpacesShenghua Wang1, 2 and Baohua Guo1, 21National Engineering Laboratory for ... H. Wang, G. Marino, and F. H. Wang, Strong convergence theorems for a generalized equilibrium problem with a relaxed monotone mapping and a countable family of nonexpansive mappings in a hilbert ... mappings in Hilbert spaces,”Journal of Mathematical Analysis and Applications, vol. 318, no. 1, pp. 43–52, 2006.4 Y. Yao, A general iterative method for a finite family of nonexpansive mappings, ”...
- 24
- 398
- 0
Báo cáo toán học: "Further applications of a power series method for pattern avoidance" ppt
... research report TH 94-04.the electronic journal of combinatorics 18 (2011), #P134 7 Further applications of a power series method for pattern avoidanceNarad Rampersad∗Department of Mathematics ... probabilistic approach to pattern avoidance using the Lov´asz local lemma (see [2, 9]). For pattern avoidance it may even be more powerful than the local lemma in certainrespects. For instance, ... 2011Mathematics Subject Classification: 68R15AbstractIn combinatorics on words, a word w over an alphabet Σ is said to avoid a pattern p over an alphabet ∆ if there is no factor x of w and no...
- 8
- 234
- 0
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf
... RESEARCH Open AccessA standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populationsKonstantinos N Fountoulakis1*, Melina Siamouli2, Stamatia ... Inventory.BMC Psychiatry 2003, 3:2.doi:10.1186/1744-859X-10-19Cite this article as: Fountoulakis et al.: A standardized scoring method for the copy of cube test, developed to be suitable for ... the current study were to developa novel and detailed standardized method of administra-tion and scoring of the copy of the Necker cube test and to preliminarily test this method in schizophrenic...
- 10
- 474
- 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA)and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele-specific primer s Pnf (AGCATTTGGTTTTAAATTATG-GAGTATATG) and Pmr (GTTTTACTTACTCTCGTCTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S,Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K,Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primarymyelofibrosis and ... with JAK2V617F, it may take many years to show a clear MPN symptom, and some may never reach the stagebefore they die of other diseases. It is also likely thatJAK2V617F-bearing cells may stay dormant...
- 7
- 435
- 0
Báo cáo y học: " The development of a knowledge test of depression and its treatment for patients suffering from non-psychotic depression: a psychometric assessment" ppt
... suffering from non-psychotic depression: a psychometric assessmentAdel Gabriel*1 and Claudio Violato2Address: 1University of Calgary and Calgary Health region, 2000 Pegasus Rd NE, Calgary AB ... Canada and 2Department Community Health Sciences, Faculty of Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary AB T2N 4N1, CanadaEmail: Adel Gabriel* - gabriel@ucalgary.ca; ... reliable and valid instruments to assess knowledge of depression by patients and the general pub-lic. Accordingly, the major purpose of the present studywas to develop and psychometrically assess...
- 15
- 416
- 0
provisional standard test method for water-soluble chloride available for corrosion of embedded steel in mortar a
... TEST METHOD FOR WATER-SOLUBLE CHLORIDE 222.1-1ACI 222.1-96 Provisional Standard Test Method for Water-Soluble Chloride Available for Corrosion of Embedded Steel in Mortar and Concrete Using ... determination of water-soluble chloride in a cementsystem.* However, some aggregates contain a considerableamount of chloride that is bound in the aggregate and is not available for the corrosion ... STANDARD 1—Scope1.1—This test method provides procedures for the sam-pling and analysis of hydraulic-cement mortar, concrete, oraggregate for chloride that is water-soluble and available for the corrosion reaction...
- 3
- 344
- 0
homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group
... HOMOMORPHISMS OF THE FUNDAMENTAL GROUP OF A SURFACE INTO PSU(1, 1), AND THE ACTION OF THE MAPPING CLASS GROUP byPanagiota Savva Konstantinou A Dissertation Submitted to the Faculty of the DEPARTMENT ... that we have read the dissertation prepared by Panagiota Savva Konstantinouentitled Homomorphisms of the Fundamental Group of a Surface into PSU(1, 1), and the Action of the Mapping Class Group and ... wishes and prayers; and my loving a supporting family: my mother Andreani, my father Sav-vas, my brothers Michael-Zenios and Charalambos.Finally I thank the Department of Mathematics at the University...
- 88
- 324
- 0
development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ
... make the WLA an ideal location for verifying the proposed in- situ dynamic liquefaction test method. In- situ liquefaction tests were carried out at three separate locations at the WLA. The tests ... Youd Development of a Direct Test Method for Dynamically Assessing the Liquefaction Resistance of Soils In Situ by Brady Ray Cox, M.S. Dissertation Presented to the Faculty of the ... side of the base plate centerline during an in- situ dynamic liquefaction test. 146 Figure 7-1 Map showing the location of the Wildlife Liquefaction Array (WLA) and the epicenters for the 1981...
- 542
- 309
- 0
Từ khóa: a view management method for mobile mixed reality systemsa simple general method for oblique rotationthe structure of a software test planissues involved when updating the primary key of a parent rowthe benefits of a hierarchythe five parts of a letterNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM