distributed decision-making and task coordination in dynamic, uncertain and real-time multiagent environments
Báo cáo y học: " Regional coordination in medical emergencies and major incidents; plan, execute and teach"
... purposes)Scandinavian Journal of Trauma, Resuscitation and Emergency MedicineOpen AccessOriginal research Regional coordination in medical emergencies and major incidents; plan, execute and teachAmir ... within the command and con-trol centre (Figure 1 and 2).A system with a duty officer (RTiB) (RN, specialized in emergency care combined with further training in disastermedicine as well as in ... be included in the riskassessment regarding possible major incidents in thisregion. The purpose of this study was to find whether thisinstitution has achieved its primary tasks by analyzing...
- 6
- 471
- 0
Báo cáo y học: "Potassium Deposition During And After Hypokinesia In Potassium Supplemented And Unsupplemented Rats"
... SD, Afonin VB and Kakurin VJ. Potassium measurements during hypokinesia and ambulation in establishing potassium changes in trained and untrained subjects. Sports Medicine Training and Rehabilitation, ... electrolyte measurements during and after hypokinesia in determining muscle electrolyte depletion during hypokinesia in rat. Biological Trace Element Research 2002; 90: 155-174. 4. Zorbas YG, Andreyev ... Federenko YF. Electrolyte metabolic changes in rats during and after exposure to hypokinesia. Physiol Chem Phys Med NMR 1996; 28: 267-277. 2. Zorbas YG, Ivanov AL, and Federenko YF. Electrolyte and...
- 7
- 402
- 0
Natural botanical products have a long history in the world and are featured in using a complex
... Int. J. Med. Sci. 2004 1(3): 137-145 138 1. Introduction Natural botanical products have a long history in the world and are featured in using a complex combination of herbs to treat various ... Tumor areas were measured every 7 days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the shortest and the longest ... apoptosis and inhibition of proliferation of gastric cancer cells. However, further clinical trials in humans are needed to examine the pharmacokinetics and the therapeutic action of CKBM on cancer...
- 9
- 712
- 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, werevealed that exon 9 played a major role in the induc-tion of mitochondria-mediated apoptosis and ... (sense) and 5Â-GAAAAAACGCGATCCTACTT-3Â (antisense). Primersfor unmethylated DNA were: 5Â-GAAGTAGGTGGAGTATTGAAT-3Â (sense) and 5Â-CAAAAAAACACAATCCTACTT-3Â (antisense).Caspase 3 activityCells subjected ... apoptosis and invasion FEBS Journal 275 (2008) 31453156 ê 2008 The Authors Journal compilation ê 2008 FEBS 3155 A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and...
- 12
- 613
- 0
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt
... functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 Judit Rumszauer, Cornelia Schwarzenlander and Beate ... represent-atives, such as Thermus thermophilus strain HB27, Thermus thermophilus HB8, Thermus flavus AT62, Thermus caldophilus, and Thermus aquaticus YT1, exhi-bit the extraordinary trait of high transformation ... implicated in retraction of the PilA4- comprising DNA translocator transporting the DNA through the periplasmic space. Binding of the DNA to the DNA-binding proteinComEA on the surface of the inner...
- 12
- 702
- 0
báo cáo sinh học:" Health workforce skill mix and task shifting in low income countries: a review of recent evidence" pptx
... alwaysbee n favo urable. In the study by Zachariah et al. of task shifting in HIV/AIDS in sub-Saharan Africa, they notequality and safety concerns, professional and institu-tional resistance, and the ... HIV/AIDS t reatment and care provided by lay and community health workers in Africa, maternal and child health care as well as themanagement of infectious diseases by lay health work-ers, and ... can present its own challenges. For example, a study analyzing task shifting in HIV/AIDS in sub-Saharan Africa noted qualit y and safety concerns, professional and institutional resistance, and...
- 11
- 600
- 0
Báo cáo hóa học: " Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach" potx
... RESEARCH Open Access Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approachIlaria Carpinella1*, Johanna Jonsdottir2 and Maurizio Ferrarin1AbstractBackground: ... time as a percen-tage of the movement duration (%Dur).Joint angle mathematical characterization and accuracyAfter data normalization, each joint angula r profile wasmathem atically characterized ... Carpinella et al.: Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach. Journalof NeuroEngineering and Rehabilitation 2011 8:19.Submit your next manuscript...
- 20
- 343
- 0
Báo cáo hóa học: "Research Article Admission Control and Interference Management in Dynamic Spectrum Access Networks" pot
... Communications and NetworkingVolume 2010, Article ID 708029, 11 pagesdoi:10.1155/2010/708029Research Article Admission Control and Interference Management in Dynamic Spectrum Access NetworksJorge Martinez-Bauset, ... impactof incorporating admission control on the forced termi-nation of SUs and also the impact of deploying channelallocation with preference and repacking on the interference. In Section ... forced termination probability and the interference created by the operation of SUs uponPUs can be controlled by limiting the access of SUs. Thisfinding motivated us to design an admission control...
- 11
- 320
- 0
ADVANCES IN WAVELET THEORY AND THEIR APPLICATIONS IN ENGINEERING, PHYSICS AND TECHNOLOGY doc
... THEORY AND THEIR APPLICATIONS IN ENGINEERING, PHYSICS AND TECHNOLOGY Edited by Dumitru Baleanu Advances in Wavelet Theory and Their Applications in Engineering, Physics and Technology ... in Engineering, Physics and Technology, Edited by Dumitru Baleanu p. cm. ISBN 978-953-51-0494-0 Advances in Wavelet Theory and Their Applications in Engineering, Physics and Technology ... speed and 1MB of RAM (TI, 2006). Advances in Wavelet Theory and Their Applications in Engineering, Physics and Technology 26The fact that the DWT approximation contains the most of the information...
- 646
- 626
- 0
Báo cáo khoa học: "Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers" pot
... cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers. World Journal of Surgical Oncology ... cancer, survive twenty months after operation, the prognosis improves and their survival becomes predictable. Introduction Colorectal cancer is the commonest maligna ncy in th egastrointestinal ... colorec-tal cancer was greatest in the first 20 months after operation. Contrary to some previous reports, survival beyond twenty months aft er operation in young patients improves and is predictable. Prognostic...
- 11
- 436
- 0
Genetic polymorphisms of matrix metalloproteinases and their inhibitors in potentially malignant and malignant lesions of the head and neck potx
... provided the original work is properly cited.Review Genetic polymorphisms of matrix metalloproteinases and their inhibitors in potentially malignant and malignant lesions of the head and neck Ajay ... as: Chaudhary et al., Genetic polymorphisms of matrix met-alloproteinases and their inhibitors in potentially malignant and malignant lesions of the head and neck Journal of Biomedical Science ... been evolvedfor the MMPs in potentially malignant and malignant lesions of the head and neck. Further research is requiredfor the development of their potential diagnostic and thera-peutic possibilities.Abbreviations(MMP):...
- 13
- 337
- 0
Báo cáo y học: "Alterations of alveolar type II cells and intraalveolar surfactant after bronchoalveolar lavage and perfluorocarbon ventilation. An electron microscopical and stereological study in the rat lung" pdf
... purposes)Respiratory ResearchOpen AccessResearchAlterations of alveolar type II cells and intraalveolar surfactant after bronchoalveolar lavage and perfluorocarbon ventilation. An electron microscopical ... concerning the quantitative changes in the intraalveolar and intracellular surfactant composition. Intraalveolar perfluorocarbons prevent end-expiratory alveolar collapse and thus, improve the BAL induced ... morphologicalapproach by transmission electron microscopy and stere-ology, as performed in the present study, allows a qualita-tive and quantitative analysis of the intraalveolar as wellas the intracellular surfactant...
- 9
- 277
- 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... fwd ACGTTGGATGGGGCACCAATTAACTAAGGCrev ACGTTGGATGTGAGGGCATGGAAGGTTCAGGCCGGCTCCCAAGCTCC 92.03S1 rs3918396 G /A 0.09 0.09 fwd ACGTTGGATGAGTCGGTAGCAACACCAGGCrev ACGTTGGATGAATCCCCGCAGACCATGACACCCTGCTGGCCATGCTCCTCAGC ... 12(page number not for citation purposes)Respiratory ResearchOpen AccessResearch The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function ... asthma by Lind [21] and Raby [6] could not findany association between single ADAM33 SNPs or haplo-types and childhood asthma. However, no analyses of ADAM33 effects on non atopic asthma have...
- 12
- 355
- 0
Từ khóa: Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP