distributed decision-making and task coordination in dynamic, uncertain and real-time multiagent environments
Báo cáo y học: " Regional coordination in medical emergencies and major incidents; plan, execute and teach"
... purposes) Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine Open Access Original research Regional coordination in medical emergencies and major incidents; plan, execute and teach Amir ... within the command and con- trol centre (Figure 1 and 2). A system with a duty officer (RTiB) (RN, specialized in emergency care combined with further train...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "Potassium Deposition During And After Hypokinesia In Potassium Supplemented And Unsupplemented Rats"
... SD, Afonin VB and Kakurin VJ. Potassium measurements during hypokinesia and ambulation in establishing potassium changes in trained and untrained subjects. Sports Medicine Training and Rehabilitation, ... electrolyte measurements during and after hypokinesia in determining muscle electrolyte depletion during hypokinesia in rat. Biological Trace Element...
Ngày tải lên: 02/11/2012, 11:12
Natural botanical products have a long history in the world and are featured in using a complex
... Int. J. Med. Sci. 2004 1(3): 137-145 138 1. Introduction Natural botanical products have a long history in the world and are featured in using a complex combination of herbs to treat various ... Tumor areas were measured every 7 days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm 3 ) = d 2 x D/...
Ngày tải lên: 03/11/2012, 09:54
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... of wild-type occludin (Occ WT ) and variant occludin in apoptosis and invasion, as determined by assay, we revealed that exon 9 played a major role in the induc- tion of mitochondria-mediated apoptosis and ... (sense) and 5Â-GAAAAAACGCGATCCTACTT-3Â (antisense). Primers for unmethylated DNA were: 5Â-GAAGTAGGTGGAGT ATTGAAT-3Â (sense) and 5Â-CAAAAAAACACAATCCT...
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt
... functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 Judit Rumszauer, Cornelia Schwarzenlander and Beate ... represent- atives, such as Thermus thermophilus strain HB27, Thermus thermophilus HB8, Thermus flavus AT62, Thermus caldophi...
Ngày tải lên: 07/03/2014, 12:20
báo cáo sinh học:" Health workforce skill mix and task shifting in low income countries: a review of recent evidence" pptx
... always bee n favo urable. In the study by Zachariah et al. of task shifting in HIV/AIDS in sub-Saharan Africa, they note quality and safety concerns, professional and institu- tional resistance, and the ... HIV/AIDS t reatment and care provided by lay and community health workers in Africa, maternal and child health care as well as the management of infectious...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach" potx
... RESEARCH Open Access Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach Ilaria Carpinella 1* , Johanna Jonsdottir 2 and Maurizio Ferrarin 1 Abstract Background: ... time as a percen- tage of the movement duration (%Dur). Joint angle mathematical characterization and accuracy After data normalization, each joint an...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: "Research Article Admission Control and Interference Management in Dynamic Spectrum Access Networks" pot
... Communications and Networking Volume 2010, Article ID 708029, 11 pages doi:10.1155/2010/708029 Research Article Admission Control and Interference Management in Dynamic Spectrum Access Networks Jorge Martinez-Bauset, ... impact of incorporating admission control on the forced termi- nation of SUs and also the impact of deploying channel allocation with preference...
Ngày tải lên: 21/06/2014, 17:20
ADVANCES IN WAVELET THEORY AND THEIR APPLICATIONS IN ENGINEERING, PHYSICS AND TECHNOLOGY doc
... THEORY AND THEIR APPLICATIONS IN ENGINEERING, PHYSICS AND TECHNOLOGY Edited by Dumitru Baleanu Advances in Wavelet Theory and Their Applications in Engineering, Physics and Technology ... in Engineering, Physics and Technology, Edited by Dumitru Baleanu p. cm. ISBN 978-953-51-0494-0 Advances in Wavelet Theory and Thei...
Ngày tải lên: 27/06/2014, 00:20
Báo cáo khoa học: "Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers" pot
... cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers. World Journal of Surgical Oncology ... cancer, survive twenty months after operation, the prognosis improves and their survival becomes predictable. Introduction...
Ngày tải lên: 09/08/2014, 03:22
Genetic polymorphisms of matrix metalloproteinases and their inhibitors in potentially malignant and malignant lesions of the head and neck potx
... provided the original work is properly cited. Review Genetic polymorphisms of matrix metalloproteinases and their inhibitors in potentially malignant and malignant lesions of the head and neck Ajay ... as: Chaudhary et al., Genetic polymorphisms of matrix met- alloproteinases and their inhibitors in potentially malignant and malig...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Alterations of alveolar type II cells and intraalveolar surfactant after bronchoalveolar lavage and perfluorocarbon ventilation. An electron microscopical and stereological study in the rat lung" pdf
... purposes) Respiratory Research Open Access Research Alterations of alveolar type II cells and intraalveolar surfactant after bronchoalveolar lavage and perfluorocarbon ventilation. An electron microscopical ... concerning the quantitative changes in the intraalveolar and intracellular surfactant composition. Intraalveolar perfluorocarbons preven...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG GCCGGCTCCCAAGCTCC 92.03 S1 rs3918396 G /A 0.09 0.09 fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGAATCCCCGCAGACCATGACAC CCTGCTGGCCATGCTCCTCAGC ... 12 (page number not for citation purposes) Respiratory Research Open Access Research The role of polymorphisms in ADAM33, a disintegrin and metalloprotease...
Ngày tải lên: 12/08/2014, 16:20
distributed decision-making and task coordination in dynamic, uncertain and real-time multiagent environments
Ngày tải lên: 14/11/2014, 12:51