... ARTICLE Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins Steffen P. Graether and Brian D. Sykes CIHR Group in Protein Structure and Function, ... would b e interesting to determine whether the insect AFPs Asn residues are also somehow involved in ice binding. Both sbwAFP and TmAFP have a capping st...
Ngày tải lên: 19/02/2014, 16:20
... seekers in the planning and delivery of mental health service provision in London. A research audit on mental health needs and mental health provision for refugees and asylum seekers ... contributing factors to the long-term mental health of refugees and asylum seekers. The fundamental challenges faced by service provider...
Ngày tải lên: 24/02/2014, 18:20
Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc
... 3 PPE Use in Healthcare Settings: Program Objectives ã Provide information on the selection and use of PPE in healthcare settings ã Practice how to safely don and remove PPE PPE Use in Healthcare ... Peel off from inside, creating a bag for both gloves ã Discard PPE Use in Healthcare Settings Slide one or two fingers of the ungloved hand under...
Ngày tải lên: 08/03/2014, 13:20
analyse the importance and impacts of corporate social responsibility (csr) in business towards the social and environmental issues in vietnam
... survey (percentage) 1 ANALYSE THE IMPORTANCE AND IMPACTS OF CORPORATE SOCIAL RESPONSIBILITY (CSR) IN BUSINESS TOWARDS THE SOCIAL AND ENVIRONMENTAL ISSUES IN VIETNAM. BY DUONG THUY ... endeavor, Vietnam had CSR Awards, which was organized by Vietnam Chamber of Commerce and Industry, Ministry of Labor-Invalids and Social Aff...
Ngày tải lên: 13/03/2014, 14:20
Báo cáo khoa học: Intermodule cooperativity in the structure and dynamics of consecutive complement control modules in human C1r Structural biology docx
... timescale in both of the free modules. Thus, these loops are strong candidates for binding sites of other complement and ⁄ or regulatory proteins. The large insertion between E and F strands in C1r ... protein module of C1r (CCP1 single ) and second complement control protein module of C1r (CCP2 single ) for the single CCP mod- ules, and CCP1 CCP2 and...
Ngày tải lên: 15/03/2014, 23:20
Clinical practice guideline for the assessment and prevention of falls in older people doc
... OLDER PEOPLE Guidelines commissioned by the National Institute for Clinical Excellence (NICE) November 2004 Clinical practice guideline for the assessment and prevention of falls in older people clinical ... 2002). Detailed examination of the MDS The content validity of the risk assessment of falls section of the MDS instrument was exa...
Ngày tải lên: 28/03/2014, 16:20
Guidelines for the Diagnosis and Management of Food Allergy in the United States docx
... THE DIAGNOSIS AND MANAGEMENT OF FOOD ALLERGY IN THE UNITED STATES 32 National Institute of Allergy and Infectious Diseases Guidelines for the Diagnosis and Management of Food Allergy ... about egg-based vaccines. NIAID I GUIDELINES FOR THE DIAGNOSIS AND MANAGEMENT OF FOOD ALLERGY IN THE UNITED STATES 18 DIAG...
Ngày tải lên: 31/03/2014, 13:20
Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf
... stand- ardized a one step single tube protocol for rapid serotyping of dengue viruses. This assay can be performed rapidly with in a period of 4 hours compared to 8 hours in two -step typing assays. ... 3' and Ts4: 5'TGTTGTCTTAAACAAGAGAGGTC3'), as reported earlier [6]. Single -step Dengue multiplex RT-PCR (M -RT-PCR) A one- step single tub...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach. Environmental Sciences ... Kraft (Duisburg, Germany) and J.T. Baker (Deventer, The Netherlands). For chemical analysis, standard stock solutions of the analytes an...
Ngày tải lên: 20/06/2014, 20:20
Báo cáo toán học: " Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces" pptx
... (2004) doi:10.1186/1687-1812-2011-106 Cite this article as: Zhu et al.: Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces. Fixed Point Theory and Applications 2011 2011:106. Submit ... Shahzad, N: Convergence theorems for a common fixed point of finite family of nonself nonexpansive mappings. Fixed...
Ngày tải lên: 20/06/2014, 21:20
báo cáo hóa học: " A protocol for the emergency department management of acute undifferentiated febrile illness in India" potx
... Chrispal A, Boorugu H, Gopinath KG, Chandy S, Prakash JA, Thomas EM, Abraham AM, Abraham OC, Thomas K: Acute undifferentiated febrile illness in adult hospitalized patients: the disease spectrum and diagnostic ... illustrate the potential for reduction in unnecessary investigations and inappropriate antimicrobial therapy. Figure 3 Final diagnosis of adult patients with a...
Ngày tải lên: 21/06/2014, 00:20
Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt
... trachea to thoracic trachea. Fig. 1. Lateral radiographs before (a) and after (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal collapse. Collapsed ... located from the mid-cervical to the thoracic trachea increased the diameter of the entire cervical to thoracic tracheal area. Coughing and dyspnea disappeared...
Ngày tải lên: 07/08/2014, 20:23
encapsulation of organophosphorus acid anhydrolase (opaa) in nanostructured materials for the detection and decontamination of chemical warfare agents
Ngày tải lên: 14/11/2014, 10:13