encapsulation of organophosphorus acid anhydrolase (opaa) in nanostructured materials for the detection and decontamination of chemical warfare agents
Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf
... ARTICLE Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins Steffen P. Graether and Brian D. SykesCIHR Group in Protein Structure and Function, ... would b e interesting todetermine whether the insect AFPs Asn residues are alsosomehow involved in ice binding.Both sbwAFP and TmAFP have a capping structure atone terminus. In the case of sbwAFP, ... determine the handedness of the proteins, ormay prevent the unfolding of the protein at cold temper-atures. The b-helix as an AFP structural motif? The sbwAFP and TmAFP structures represent the firstAFPs...
- 12
- 716
- 0
Tài liệu ‘Unheard voices’: listening to Refugees and Asylum seekers in the planning and delivery of mental health service provision in London. pptx
... seekers in the planning and delivery of mental health service provision in London. A research audit on mental health needs and mental health provision for refugees and asylum seekers ... contributing factors to the long-term mental health of refugees and asylum seekers. The fundamental challenges faced by service providers in the mental health and social care sector is to incorporate ... barriers include language, GPs not having the time to talk to people and find out what the problems are, lack of knowledge of mental health services in refugees and asylum seekers, long waiting...
- 92
- 1,134
- 0
Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc
... 3PPE Use in Healthcare Settings: Program Objectivesã Provide information on the selection and use of PPE in healthcare settings ã Practice how to safely don and remove PPEPPE Use in Healthcare ... Peel off from inside, creating a bag for both glovesã DiscardPPE Use in Healthcare Settings Slide one or two fingers of the ungloved hand under the wrist of the remaining glove. Peel glove off ... hand, turning glove inside-outã Hold in opposite gloved handPPE Use in Healthcare Settings Using one gloved hand, grasp the outside of the opposite glove near the wrist. Pull and peel the...
- 49
- 644
- 0
analyse the importance and impacts of corporate social responsibility (csr) in business towards the social and environmental issues in vietnam
... survey (percentage) 1 ANALYSE THE IMPORTANCE AND IMPACTS OF CORPORATE SOCIAL RESPONSIBILITY (CSR) IN BUSINESS TOWARDS THE SOCIAL AND ENVIRONMENTAL ISSUES IN VIETNAM. BY DUONG THUY ... endeavor, Vietnam had CSR Awards, which was organized by Vietnam Chamber of Commerce and Industry, Ministry of Labor-Invalids and Social Affairs, Vietnam Ministry of Industry and Trade since 2005, ... action + Rejecting or minimizing the subjectivity of the judgments and accepts the vertical measure of the results of the study subjects. The weaknesses of the quantitative method include: +...
- 64
- 782
- 4
Báo cáo khoa học: Intermodule cooperativity in the structure and dynamics of consecutive complement control modules in human C1r Structural biology docx
... timescale in both of the free modules. Thus, these loops are strong candidates for binding sites of other complement and ⁄ or regulatory proteins. The large insertion between E and F strands in C1r ... protein module of C1r (CCP1single) and second complement control proteinmodule of C1r (CCP2single) for the single CCP mod-ules, and CCP1CCP2 and CCP1CCP2 for the corre-sponding modules ... in CCP1CCP2, which is exactly the reverse of the situationobserved for the CCP1single and CCP2single modules and probably reflects the complex interdependence of the modules in terms of internal...
- 13
- 583
- 0
Clinical practice guideline for the assessment and prevention of falls in older people doc
... OLDER PEOPLE Guidelines commissioned by the NationalInstitute for Clinical Excellence (NICE)November 2004 Clinical practice guideline for the assessment and prevention of falls in older people clinical ... 2002).Detailed examination of the MDS The content validity of the risk assessment of falls section of the MDS instrument was examined and information on the utility of the instrument in practice in relation ... measure of reducing the impact of the fall and thereby the chance of fracturing the hip .The fractureis usually the result of a fall. The fall usually occurs whilststanding or walking and the impact...
- 284
- 2,441
- 0
Guidelines for the Diagnosis and Management of Food Allergy in the United States docx
... THE DIAGNOSIS AND MANAGEMENT OF FOOD ALLERGY IN THE UNITED STATES 32 National Institute of Allergy and Infectious Diseases Guidelines for the Diagnosis and Management of Food Allergy ... about egg-based vaccines. NIAID I GUIDELINES FOR THE DIAGNOSIS AND MANAGEMENT OF FOOD ALLERGY IN THE UNITED STATES 18 DIAGNOSIS OF FOOD ALLERGY Food protein-induced allergic proctocolitis ... FAMILIES, AND CAREGIVERS 3 NIAID I GUIDELINES FOR THE DIAGNOSIS AND MANAGEMENT OF FOOD ALLERGY IN THE UNITED STATES 14 DIAGNOSIS OF FOOD ALLERGY Allergen-specific IgE in the...
- 36
- 581
- 0
Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf
... stand-ardized a one step single tube protocol for rapid serotyping of dengue viruses. This assay can be performedrapidly with in a period of 4 hours compared to 8 hoursin two -step typing assays. ... 3' and Ts4:5'TGTTGTCTTAAACAAGAGAGGTC3'), as reported earlier[6]. Single -step Dengue multiplex RT-PCR (M -RT-PCR) A one- step single tube serotype-specific multiplex PCRwas performed ... useful for rapid diagnosis and serotyping of viruses in dengue infections.Table 2: Comparison of Multiplex PCR and Virus isolation for the detection and serotyping of dengue viruses from acute...
- 5
- 482
- 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach. EnvironmentalSciences ... Kraft (Duisburg,Germany) and J.T. Baker (Deventer, The Netherlands).For chemical analysis, standard stock solutions of the analytes and the internal standards were prepared both in methanol and ... of analytes. For the quantita-tion of the analytes, a 5-point (PAHs) and a 7-po int(pharmaceuticals) internal standard calibration was used. The limit of detection and the LOQ were calculated...
- 13
- 589
- 0
Báo cáo toán học: " Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces" pptx
... (2004)doi:10.1186/1687-1812-2011-106Cite this article as: Zhu et al.: Weak convergence theorem for the three-step iterations of non-Lipschitzian nonself mappings in Banach spaces. Fixed Point Theory and Applications 2011 2011:106.Submit ... Shahzad, N: Convergence theorems for a common fixed point of finite family of nonself nonexpansive mappings. Fixed Point Theory Appl. 2005,1–9 (2005)15. Shahzad, N: Approximating fixed points of non-self ... 225002, ChinaAbstract In this article, we introduce a new three-step iterative scheme for the mappings which are asymptotically nonexpansive in the intermediate sense in Banach spaces. Weak convergence...
- 13
- 360
- 0
báo cáo hóa học: " A protocol for the emergency department management of acute undifferentiated febrile illness in India" potx
... Chrispal A, Boorugu H, Gopinath KG, Chandy S, Prakash JA, Thomas EM,Abraham AM, Abraham OC, Thomas K: Acute undifferentiated febrile illness in adult hospitalized patients: the disease spectrum anddiagnostic ... illustrate the potential for reduction in unnecessaryinvestigations and inappropriate antimicrobial therapy.Figure 3 Final diagnosis of adult patients with acute undifferentiated fever.Thangarasu ... al.: A protocol for the emergency department management of acute undifferentiated febrile illness in India. International Journal of Emergency Medicine 2011 4:57.Submit your manuscript to a journal...
- 4
- 342
- 0
Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt
... trachea to thoracic trachea.Fig. 1. Lateral radiographs before (a) and after (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal collapse. Collapsed ... located from the mid-cervical to the thoracic trachea increased the diameter of the entire cervical to thoracic tracheal area. Coughing and dyspnea disappeared and the dogs resumed normal activity. ... Joon-young Kim et al.Table 1. Effect of self expandable intratracheal nitinol stent on clinical signs in dogs with tracheal collapse Case Breed Age Sex Weight Grade of Stent size Site of stent ResultsNo....
- 3
- 576
- 0
Từ khóa: resulting in dramatic increases in healthcare costs understanding the processes and metabolic perturbations that contribute to the expansion of adipose depots accompanying obesity is central to the development of appropriate therapeutic strategiesthe detection and representation of ambiguitiesdigital image processing techniques for the detection and removal of cracks in digitized paintings pptdigital image processing techniques for the detection and removal of cracks in digitized paintingsreasons for the rise and fall of ancient greek civilizationNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ