... (IADL)" and included ability to travel outside, go shopping, prepare own meals and handle money. A limited number of tests of physical performance for assessing the functioning of upper and ... thank Dr. Joe Fernando Secretary, Dr. George Fernando Director General of Health Services of the Ministry of Health and Women's Affairs, Sri Lanka and D...
Ngày tải lên: 14/02/2014, 06:20
... 10 6 (10 0%) Guanine PRTFDC1 36 .1 ± 14 .3 2.9 ± 0.7 1. 36 ± 0.34 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) HPRT 9.9 ± 0.2 899 ± 11 7 406 ± 53 4.5 · 10 7 ± 1. 0 · 10 7 (10 0%) M. Welin et al. Studies of the human ... Gene duplication and inactivation in the HPRT gene family. Genomics 89 , 13 4 14 2. 11 Nicklas JA (2006) Pseudogenes of the human HPRT1 gene. Environ M...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... 5859 Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium A. Pappachan 1 , H. S. Savithri 2 and M. R. N. Murthy 1 1 Molecular ... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: The Mycobacterium tuberculosis membrane protein Rv2560 ) biochemical and functional studies pdf
... chlor- amine-T (2.25 mgặmL )1 ) and 3.2 lLNa 125 I (100 mCiặmL )1 ) were added to 5 lL peptide solution (1 lgặlL )1 ); 15 lL sodium bisulte (2.75 mgặmL )1 ) and 50 lL NaI (0.16 m) were added after 5 ... preimmune and post-third inoculation sera against a M. tuberculosis sonicate (lanes 1, 2 and 5) and a membrane frac- tion (lanes 3 and 4). Lanes...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity Louise Egeblad-Welin 1,2,* , ... 2007) doi:10.1111/j.1742-4658.2007.05701.x The catalytic reaction mechanism and binding of substrates was investi- gated for the multisubs...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx
... structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain Yoko Kobayashi, Toshiaki Nakajima and Ituro Inoue Division of Genetic Diagnosis, Institute of Medical ... orientation, the catalytic site in the N-terminal domain of one subunit and the substrate recognition site in the C-terminal domain of the other f...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot
... 2008 The Authors Journal compilation ê 2008 FEBS 697 Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk ... is known of the functions of non- ES CHH than of those of its counterpart present in ESs. In the blue crab, Calline...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Comparative biochemical and functional studies of family I soluble inorganic pyrophosphatases from photosynthetic bacteria potx
... FEBS. No claim to original US government works 3951 Comparative biochemical and functional studies of family I soluble inorganic pyrophosphatases from photosynthetic bacteria Marı ´ aR.Go ´ mez-Garcı ´ a*, ... (2002) Expression studies of two paralogous ppa genes enco- ding distinct family I pyrophosphatases in marine uni- cellular cyanobacteria reveal i...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Submembraneous microtubule cytoskeleton: biochemical and functional interplay of TRP channels with the cytoskeleton pot
... progress in the study of TRP channels as well as other ion channels in the context of both actin and the microtubule cytoskel- eton. The presence of the microtubule cytoskeleton at the membrane ... involved in the detec- tion and ⁄ or transduction of physical and chemical stimuli. TRPV1 and the cytoskeleton Physical interaction of TRPV1 with...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo hóa học: "Research Article Novel Heuristics for Cell Radius Determination in WCDMA Systems and Their Application to Strategic Planning Studies" potx
... 314814, 14 pages doi:10.1155/2009/314814 Research Article NovelHeuristicsforCellRadiusDeterminationinWCDMA Systems and Their Application to Strategic Planning Studies A. Portilla-Figueras, 1 S. Salcedo-Sanz, 1 Klaus ... represent a novelty in strategic network planning studies. The proposed heuristics are implemented in a strategic planning software tool and an...
Ngày tải lên: 21/06/2014, 23:20
Báo cáo hóa học: " In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics" doc
... borohydride and antibiotics were used to reduce H[AuCl 4 ]. The seeding of Gnps was done in presence of the antibiotics (Ampi- cillin, Streptomycin and Kanamycin, Fig. 1) individually and thus Gnps conjugated ... delocalization of the electron in the carbonyl group of the b-lactam ring in ampicillin at elevated temperature. Elevation in tempera- ture might induce break...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo hóa học: " In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics" pdf
... borohydride and antibiotics were used to reduce H[AuCl 4 ]. The seeding of Gnps was done in presence of the antibiotics (Ampi- cillin, Streptomycin and Kanamycin, Fig. 1) individually and thus Gnps conjugated ... Published online: 17 November 2007 Ó to the authors 2007 Abstract Bactericidal efficacy of gold nanoparticles conjugated with ampicillin, streptomycin and kana...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo y học: "Influence of enrollment sequence effect on observed outcomes in the ADDRESS and PROWESS studies of drotrecogin alfa (activated) in patients with severe sepsis" pptx
... exploratory analyses of both the PROWESS and ADDRESS databases. We discuss the results of these analy- ses in the context of their implication on the design and con- duct of future clinical trials in patients ... and EA participated in the conception and design of the study, in the development and conduct of analyses, and in the clinic...
Ngày tải lên: 13/08/2014, 11:22
biochemical and structural studies of escherichia coli leucine-responsive regulatory protein
... UNIVERSITY OF CALIFORNIA Santa Barbara Biochemical and Structural Studies of Escherichia coli Leucine-responsive regulatory protein A Dissertation submitted in partial satisfaction of the ... Topic: Biochemical and Structural Studies of Escherichia coli Leucine-responsive Regulatory Protein Experience 1997-1998 Teaching Assistant De...
Ngày tải lên: 14/11/2014, 06:09
sex determination in drosophila biochemical and functional studies of transcription factor doublesex
Ngày tải lên: 14/11/2014, 08:21