preparation and functionalization of macromolecule-metal and metal oxide nanocomplexes for biomedical applications

... Figure 1 for the investigation of the thermal stability of the PVDF membrane, PVDF-PS membrane, and the PVDF-SPS composite membrane. For the pristine PVDF membrane (curve Figure 1a), the PVDF ... has the larger pores than the PVDF-PS membrane and the PVDF-SPS membrane. The mean pore diameter of the PVDF membrane, the PVDF-PS membrane and t...

Ngày tải lên: 05/09/2013, 16:11

... catering (including vending machines) and the food and drink children bring into school, the taught curriculum (including PE), school travel plans and provision for cycling, and policies relating ... Section 3 on pages 59 and 60 has links to tools to help with implementing the recommendations, meeting training needs, evaluating the impact of action and working...

Ngày tải lên: 21/02/2014, 11:20

... 10.1146/annurev.matsci.34.040203.112141 Copyright c  2004 by Annual Reviews. All rights reserved CHEMICAL SENSING AND CATALYSIS BY ONE- DIMENSIONAL METAL- OXIDE NANOSTRUCTURES Andrei Kolmakov and Martin Moskovits Department of Chemistry and Biochemistry, ... properties of metal oxides (4, 12–14). Chemical and biological sensors having nanostructured metal oxid...

Ngày tải lên: 19/03/2014, 16:47

... evidence of effectiveness, including cost effectiveness. They include recommendations on the clinical management of overweight and obesity in the NHS, and advice on the prevention of overweight and ... overweight and obesity in adults and children in England and Wales. The guidance aims to: ã stem the rising prevalence of obesity...

Ngày tải lên: 22/03/2014, 09:20

... Biochem. 270) 4829 Perturbation of folding and reassociation of lactate dehydrogenase by proline and trimethylamine oxide Oscar P. Chilson and Anne E. Chilson Department of Biology, Washington ... effects of proline and TMAO on the structure and/ or function of lactate dehydrogenase are based on investigations performed by Bolen and coworkers [3...

Ngày tải lên: 23/03/2014, 15:21

... 8:96 http://www.hqlo.com/content/8/1/96 Page 5 of 10 RESEARC H Open Access Uncontrolled asthma: assessing quality of life and productivity of children and their caregivers using a cross-sectional Internet-based survey Bonnie B Dean 1* , ... 8:96 http://www.hqlo.com/content/8/1/96 Page 9 of 10 asthma, the mean response of caregivers of children w...

Ngày tải lên: 20/06/2014, 16:20

... 6:540 http://www.nanoscalereslett.com/content/6/1/540 Page 3 of 8 NANO EXPRESS Open Access Superparamagnetic iron oxide nanoparticle attachment on array of micro test tubes and microbeakers formed on p-type silicon substrate for ... distributed array of micro test tubes and microbeakers is formed on a p-type silicon substrate wi...

Ngày tải lên: 20/06/2014, 22:20

... fusion of the drug from inne r phase and then slower release. Ne vertheless, the release rate of mixed micelles was faster than that of CLE before the first 12 h, the release rate of the two formulations ... 6:275 http://www.nanoscalereslett.com/content/6/1/275 Page 8 of 9 NANO EXPRESS Open Access Preparation and evaluation of novel mixed micelles as nanocarrie...

Ngày tải lên: 21/06/2014, 04:20

... and reduction of samples of lime and limestone products to be used for physical and chemical tests. 1.2 This practice further covers inspection, rejection, retest- ing, packing, and marking of lime and limestone ... nature of the test described within this standard, a finely pulverized homogenous sample is required regardless of the analytical sample size. C5...

Ngày tải lên: 10/07/2014, 23:20

... (2004), / 5 (1), 59–62 Effect of ultraviolet radiation on the hatchability and survival of eggs and larvae of sheep nematode Ademola Isaiah Oluwafemi* and Ademola Janet Ayobami 1 Department of Veterinary ... of change in UV radiation intensities base on length of exposure on the hatching of nematode eggs as well as the survival rate of...

Ngày tải lên: 07/08/2014, 17:22

... et al.: Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G > A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic ... tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgt...

Ngày tải lên: 10/08/2014, 10:21

... 52:48 http://www.actavetscand.com/content/52/1/48 Page 9 of 10 RESEARC H Open Access Pyelonephritis in slaughter pigs and sows: Morphological characterization and aspects of pathogenesis and aetiology Louise K Isling 1* , ... purpose of the present study was to describe the morphology, investigate the pathogenesis, and evaluate the aetiological role of E. c...

Ngày tải lên: 12/08/2014, 18:22

... Preparation and Functionalization of Macromolecule -Metal and Metal Oxide Nanocomplexes for Biomedical Applications by Michael L. Vadala ... Macromolecule -Metal and Metal Oxide Nanocomplexes For Biomedical Applications Michael L. Vadala Abstract Copolymer-cobalt complexes have been formed by thermolysis of dicobalt octacar...

Ngày tải lên: 13/11/2014, 16:16

Ngày tải lên: 13/03/2015, 10:12