electro-osmotic grouting technique for liquefaction-mitigation of low permeability silty soils
Tài liệu Báo cáo khoa học: Simplified yet highly accurate enzyme kinetics for cases of low substrate concentrations ppt
... 2009 FEBS Simplified yet highly accurate enzyme kinetics for cases of low substrate concentrations Hanna M. Ha ă rdin 1,2 , Antonios Zagaris 2,3 , Klaas Krab 1 and Hans V. Westerhoff 1,4,5 1 ... where the concentrations of enzymes and binding sites are often of the same order of magnitude. In all of these cases, the accuracy of Michaelis–Menten kinetics...
Ngày tải lên: 18/02/2014, 06:20
Báo cáo khoa học: Piezoelectric sensors based on molecular imprinted polymers for detection of low molecular mass analytes potx
... compilation ª 2007 FEBS 5477 MINIREVIEW Piezoelectric sensors based on molecular imprinted polymers for detection of low molecular mass analytes Yildiz Uludag ˘ 1,2 , Sergey A.Piletsky 1 , Anthony ... is still a significant issue for imprinted polymers and this can hamper specific, sensitive detection of analytes in Y. Uludag ˘ et al. Detection of l...
Ngày tải lên: 23/03/2014, 07:20
Novel technique for rapid detection of a-globin gene mutations and deletions pot
... screening. Translational Research Volume 155, Number 3 Liu et al 149 Novel technique for rapid detection of a-globin gene mutations and deletions JINGZHONG LIU, XINGYUAN JIA, NING TANG, XU ZHANG, XIAOYI ... frequencies of a-thalassemia caused by a-globin gene mutations and deletions. This study was designed to find an efficient and simple diag- nostic test f...
Ngày tải lên: 23/03/2014, 22:20
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx
... ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature Ajit K. Satapathy, Theetha L. Pavankumar, Sumana Bhattacharjya, Rajan ... Nonetheless, the present study identifies the significance of the RecD- associated ATPase activity required during the growth of P. syringae at low temp...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: "A Figure of Merit Technique for the Resolution of Non-Grammatical Ambiguity" ppt
... Details of the Figure of Merit Technique The figure of merit technique uses the probability measures of the single meaning words in an article (or sentence) to obtain a measure of the context ... with a total of 172 English equivalents. The figure of merit technique enabled the choice of correct equiv- alents for 66 out of the 76 mult...
Ngày tải lên: 30/03/2014, 17:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" New fluoroscopic imaging technique for investigation of 6DOF knee kinematics during treadmill gait" pot
... citation purposes) Journal of Orthopaedic Surgery and Research Open Access Technical Note New fluoroscopic imaging technique for investigation of 6DOF knee kinematics during treadmill gait Guoan ... presents a new imaging technique for non-invasive study of six degrees of freedom (DOF) knee kinematics during treadmill gait. Materials and methods:...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... critical iterations on the initial manuscript were a joint effort of all authors. All authors read and approved the final man- uscript. Appendix The intra-operatively manufactured prosthesis In the ... IMP-procedure, the stem of the prosthesis is custom made for each individual patient, during the operation [27]. After reaming of the femoral cavity, a 3D imprint...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Paradox of low field enhancement factor for field emission nanodiodes in relation to quantum screening effects" doc
... 1 Paradox of low field enhancement factor for field emission nanodiodes in relation to quantum screening effects Tsung-Chieh Cheng* 1 , Pai-Yen Chen 2 , and Shen-Yao Wu 1 1 Department of ... text (HTML) versions will be made available soon. Paradox of low field enhancement factor for field emission nanodiodes in relation to quan...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article Interference Mitigation Technique for Coexistence of Pulse-Based UWB and OFDM" doc
... pages doi:10.1155/2008/285683 Research Article Interference Mitigation Technique for Coexistence of Pulse-Based UWB and OFDM Kohei Ohno and Tetsushi Ikegami Department of Electronics and Communications, ... of UWB should mitigate the effect of interference with OFDM. The p -UWB interference signal is also derived from the OFDM receiver to demonstrate the...
Ngày tải lên: 21/06/2014, 22:20
báo cáo khoa học: " Piezoelectric-assisted removal of a benign fibrous histiocytoma of the mandible: An innovative technique for prevention of dentoalveolar nerve injury" pps
... fibrous histiocytoma of the mandible: An innovative technique for prevention of dentoalveolar nerve injury Maximilian EH Wagner 1† , Majeed Rana 1*† , Wolfgang Traenkenschuh 2 , Horst Kokemueller 1 , André ... Contributed equally 1 Department of Cranio-Maxillo-Facial Surgery, Hannover Medical School, Germany Full list of author information is available at the e...
Ngày tải lên: 11/08/2014, 20:21
the study in application of laparoscopic abdominoperineal resection for treatment of low rectal cancer
... lymphadenectomy in laparoscopic abdominoperineal resection for treatment of low rectal cancer. 2. Evaluate results of laparoscopic abdominoperineal resection (LAPR) for treatment of low rectal cancer ... limited. Due to the above issues, we implemented the study " ;The study in application of laparoscopic abdominoperineal resecti...
Ngày tải lên: 10/10/2014, 23:25
development of a mid-infrared technique for determination of soil nitrate content
Ngày tải lên: 13/11/2014, 09:34
electro-osmotic grouting technique for liquefaction-mitigation of low permeability silty soils
... ELECTRO-OSMOTIC GROUTING TECHNIQUE FOR LIQUEFACTION-MITIGATION OF LOW PERMEABILITY SILTY SOILS by WEIWEI JIA September 2006 ... the increase of liquefaction resistance in silty soils due to electro-osmotic grouting, and to design grout mixes feasible for electro-osmotic grouting. Numerical analyses were performed to simulate ... Guidelines...
Ngày tải lên: 13/11/2014, 10:40