role of plant growth-promoting rhizobacteria in integrated disease management and productivity of tomato

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... [8] and Ras guanine exchange factor (RasGEF) very- KIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9]. The KIND domain in these proteins is localized to the N-terminal region, and ... 2011 The Authors Journal compilation ê 2011 FEBS Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein...

Ngày tải lên: 14/02/2014, 19:20

11 659 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... dependence of the steady-state kinetic parameters of MAO A- catalysed oxidation of benzyl- amine at 20 °C. Fig. S2. pH dependence of the reductive half-reaction of MAO A- catalysed oxidation of benzylamine ... was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5Â-GTCTTCGAA A CCATGGAGAATCAAGAGAAGGCGAGTATCGCGG G-3Â a...

Ngày tải lên: 07/03/2014, 06:20

9 327 0
Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

... documents and find that the fea- ture vectors corresponding to some of these docu- ments (particularly the short ones) have all zeroes in them. In other words, none of the bigrams from the training ... processing systems. We will focus on an important linguistic aspect of polarity classification: examining the role of a variety of simple, yet under-investigated,...

Ngày tải lên: 17/03/2014, 04:20

8 489 0
.Paleontology and Geology of Laetoli: Human Evolution in Context.Vertebrate Paleobiology and Paleoanthropology SeriesEdited by Eric DelsonVertebrate Paleontology, American Museum of Natural History, New York, NY 10024, USA delson@amnh.orgEric J. Sar pdf

.Paleontology and Geology of Laetoli: Human Evolution in Context.Vertebrate Paleobiology and Paleoanthropology SeriesEdited by Eric DelsonVertebrate Paleontology, American Museum of Natural History, New York, NY 10024, USA delson@amnh.orgEric J. Sar pdf

... Tanzania Alisa J. Winkler and Yukimitsu Tomida T. Harrison (ed.), Paleontology and Geology of Laetoli: Human Evolution in Context. Volume 2: Fossil Hominins and the Associated Fauna, Vertebrate Paleobiology ... 1.40–1.50 (continued) 1 T. Harrison (ed.), Paleontology and Geology of Laetoli: Human Evolution in Context. Volume 2: Fossil Hominins and the As...

Ngày tải lên: 29/03/2014, 18:20

615 3,4K 0
Báo cáo y học: "Potential involvement of oxidative stress in cartilage senescence and development of osteoarthritis: oxidative stress induces chondrocyte telomere instability and downregulation of chondrocyte function" pptx

Báo cáo y học: "Potential involvement of oxidative stress in cartilage senescence and development of osteoarthritis: oxidative stress induces chondrocyte telomere instability and downregulation of chondrocyte function" pptx

... presence of oxidative stress induces telomere genomic instability, replicative senescence and dysfunction of chondrocytes in OA cartilage, suggesting that oxidative stress, leading to chondrocyte senescence ... senescence and oxidative stress in OA cartilage, as discussed above, we postulated that oxidative stress induces telomere instability...

Ngày tải lên: 09/08/2014, 06:22

12 407 0
Báo cáo y học: "Gene expression and activity of cartilage degrading glycosidases in human rheumatoid arthritis and osteoarthritis synovial fibroblast" potx

Báo cáo y học: "Gene expression and activity of cartilage degrading glycosidases in human rheumatoid arthritis and osteoarthritis synovial fibroblast" potx

... MMPs, proinflammatory cytokines and chemokines [13]. There is increasing evidence that SFs are key players in the pathogenesis of RA by invading and eroding hyaline cartilage. SFs, activated locally, ... expression in both rheumatoid arthritis and osteoarthritis derived synovial fibroblasts. In addition, expression of cartilage- degrading glycosidases was mo...

Ngày tải lên: 09/08/2014, 14:20

13 681 1
báo cáo khoa học: " The role and challenges of the food industry in addressing chronic disease" docx

báo cáo khoa học: " The role and challenges of the food industry in addressing chronic disease" docx

... many independent monitoring schemes that include the Dow Jones Sustainability Index and the Global Reporting Initiative[29]. Their reports to the investor and business community create incentives for ... industry groups in over 15 countries/regions, including the 27 countries of the European Union and the 6 countries of the Cooperation Council for the Arab Stat...

Ngày tải lên: 11/08/2014, 14:21

8 480 0
Báo cáo y học: " Prevalence of obsessive-compulsive disorder in Turkish university students and assessment of associated factorsb" docx

Báo cáo y học: " Prevalence of obsessive-compulsive disorder in Turkish university students and assessment of associated factorsb" docx

... life events, and modeling parental behavior are all implicated in the etiology of the disorder. Clinical obsessions include the fear of dirt/germs, a yearning for symmetry/certainty, suspicion, sexuality, ... surveys that investigate the epidemiology of OCD in university students. Therefore, the goal of this study is to determine the life- long prevalence and accompanyi...

Ngày tải lên: 11/08/2014, 17:20

8 299 0
báo cáo khoa học: " Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data" potx

báo cáo khoa học: " Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data" potx

... 10:49 http://www.biomedcentral.com/1471-2229/10/49 Page 11 of 12 RESEARC H ARTIC LE Open Access Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data Sinara ... this article as: Artico et al.: Identification and evaluation of new reference genes in Gossyp...

Ngày tải lên: 12/08/2014, 03:21

12 390 0
Báo cáo y học: "Association of chemokine receptor gene (CCR2CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians" pdf

Báo cáo y học: "Association of chemokine receptor gene (CCR2CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians" pdf

... Association of chemokine receptor gene (CCR2-CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians. Retrovirology 2011 8:22. Submit your next manuscript to BioMed Central and take ... evidence for invol- vement of variants in these genes in both control and occurrence of HIV-1 infection. HHE was associated with slightly high...

Ngày tải lên: 13/08/2014, 01:20

9 386 0
Báo cáo y học: "Critical care management and outcome of severe Pneumocystis pneumonia in patients with and without HIV infection" pps

Báo cáo y học: "Critical care management and outcome of severe Pneumocystis pneumonia in patients with and without HIV infection" pps

... admissions in the intensive care unit (ICU) of cases with Pneumocystis pneumonia in patients infected (HIV- posi-tive) and not infected (HIV- negative) with HIVYearly proportion among all admissions in ... proportion of patients with and without HIV infection, non-invasive ventilation failed in a very high proportion of HIV- negative patients but succ...

Ngày tải lên: 13/08/2014, 10:20

9 338 0
improving the quality of retail banking services in bank for investment and development of vietnam - hanoi branch south

improving the quality of retail banking services in bank for investment and development of vietnam - hanoi branch south

... Evaluate the real situation of the retail banking service quality of BIDV- Southern Hanoi Branch. - Suggest some solutions for increasing the retail banking service quality of BIDV- Southern Hanoi Branch. ... evaluation of retail banking service system in BIDV- Southern Hanoi Branch, analyzing the achievements and failures in the retail...

Ngày tải lên: 06/10/2014, 06:36

101 1,1K 16
role of plant growth-promoting rhizobacteria in integrated disease management and productivity of tomato

role of plant growth-promoting rhizobacteria in integrated disease management and productivity of tomato

... ROLE OF PLANT GROWTH-PROMOTING RHIZOBACTERIA IN INTEGRATED DISEASE MANAGEMENT AND PRODUCTIVITY OF TOMATO DISSERTATION Presented in Partial Fulfillment of the Requirements ... mutants of plant growth-promoting rhizobacteria (PGPR) (Bacillus subtilis MBI600 and GBO3, and B. amyloliquefaciens IN9 37) on height of ‘Mountain Spring’ tomato seed...

Ngày tải lên: 13/11/2014, 10:28

266 588 0
the role of fgfr3 mutation in tumour initiation, progression and invasion of urothelial cell carcinoma in mice

the role of fgfr3 mutation in tumour initiation, progression and invasion of urothelial cell carcinoma in mice

... The role of FGFR3 mutation in tumour initiation, progression and invasion of urothelial cell carcinoma in mice Mona Foth Submitted in fulfilment of the requirements for the Degree of ... Glasgow Theses Service http://theses.gla.ac.uk/ theses@gla.ac.uk Foth, Mona (2014) The role of FGFR3 mutation in tumour initiation...

Ngày tải lên: 22/12/2014, 20:56

280 292 0
w