... 40 - Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge Toshikazu Fukushima*, Naoki Uda*, Motoharu Onuki**, ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the labo...
Ngày tải lên: 05/09/2013, 09:38
... diagram Fig 8. Software interface TẠP CHÍ PHÁT TRIỂN KH&CN, TẬP 11, SỐ 03 - 2008 Trang 49 DEVELOPMENT OF AN AUTOUMATIC DATA PROCESSING FOR TRIAXIAL COMPRESSION TEST Pham Hong ... Menzies, B.K., A Computer Controlled Hydraulic Triaxial Testing System , Advanced Triaxial Testing of Soil and Rock, American Society for Testing Materials - Speci...
Ngày tải lên: 10/12/2013, 06:15
study of wo3-based sensing materials for nh3 and no detection
... 1999 Abstract Gas sensing materials of WO loaded with 1 wt.% metal oxides were prepared and applied for NH and NO detection. The 3 3 measurement of NH and NO sensing properties of the materials revealed ... and Actuators B 66 2000 74–76 www.elsevier.nlrlocatersensorb Study of WO -based sensing materials for NH and NO detection 33 Xusheng Wang a,) ,...
Ngày tải lên: 20/03/2014, 13:08
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific antagonist for corticotropin-releasing factor (CRF) receptor, type 2 (CRF 2 ), has been synthesized and characterized. ... indicated on the right and left. Ó FEBS 20 02 Photoactivatable CRF 2 receptor antagonist (Eur. J. Biochem. 26 9) 529 3 Development of a sele...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo sinh học: " Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pdf
... contributions Design and conception of the study and co-drafted the manuscript (DPY); development of the methods and co- drafted the manuscript (EZ); assisted in the development of the automated plaque counting ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutraliz- ing antibody titers. The 180 te...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pptx
... Central Page 1 of 5 (page number not for citation purposes) Virology Journal Open Access Methodology Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutraliz- ing antibody titers. T...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo sinh học: "Genomics technology for assessing soil pollutio" pps
... of contact between pollutants and soil. Appropriate risk assessment of contaminants is therefore geared towards assessing the biological effects of a polluted soil, rather than the total concentration ... have already gained international acceptance through, for example, Organization for Economic Co-operation and Development (OECD) or International Organization for Standardization (...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc
... (principal component analysis and isomap method) Brain plan evaluation for (a) ANFIS and (b) human planFigure 7 Brain plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... TPS at the level of deliverable plans Prostate plan evaluation for (a) ANFIS and (b) human planFigure 6 Prostate plan evaluation for (a) ANFIS and (b) human plan. The DVHs are show...
Ngày tải lên: 09/08/2014, 10:20
Development of a liposomal nanodelivery system for nevirapine ppsx
... cited. Research Development of a liposomal nanodelivery system for nevirapine Lakshmi N Ramana 1 , Swaminathan Sethuraman 1 , Udaykumar Ranga 2 and Uma M Krishnan* 1 Abstract Background: The treatment ... 10.1186/1423-0127-17-57 Cite this article as: Ramana et al., Development of a liposomal nanodelivery system for nevirapine Journal of Biomedical Science 20...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx
... develop a synoptic MRI report for primary rectal cancer, and to elicit the opinions of radiologists regarding enablers and barriers towards the implementation and sustainability of synop- tic reports ... present and describe key elements or templates for MRI reporting of rectal cancer. Data on type of article, citation, and key criteria will be extracted and tabula...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc
... information in a tabular, rather than descriptive form. Templates are created specif- ically for a particular setting and can be filled in by the reporting physician. Synoptic reports are of ... is an extremely important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and doc- umentation of...
Ngày tải lên: 11/08/2014, 16:20
báo cáo khoa học:" Study on the clinical application of pulsed DC magnetic technology for tracking of intraoperative head motion during frameless stereotaxy" pdf
... pin fixation of the head is no longer required. For all other procedures, continuous tracking of head motion ensures automatic correction of spatial distortion with mechani- cal alteration of the head ... Central Page 1 of 16 (page number not for citation purposes) Head & Face Medicine Open Access Research Study on the clinical application of pul...
Ngày tải lên: 11/08/2014, 23:22
development of on-the-go soil sensing technology for mapping soil ph, potassium and nitrate contents
... ProQuest Information and Learning Company. ii DEVELOPMENT OF ON-THE-GO SOIL SENSORS FOR MAPPING SOIL pH, POTASSIUM AND NITRATE CONTENTS Balaji Sethuramasamyraja, Ph. D. University of Nebraska, ... DEVELOPMENT OF ON-THE-GO SOIL SENSING TECHNOLOGY FOR MAPPING SOIL pH, POTASSIUM AND NITRATE CONTENTS by Balaji Sethuramasam...
Ngày tải lên: 13/11/2014, 09:17
development of a mid-infrared technique for determination of soil nitrate content
Ngày tải lên: 13/11/2014, 09:34