algorithms for representation and discovery of transcription factor binding sites

... proteins are able to bind in vitro to P1 promoter sequences of the AbH-J-J gene locus. ChIP assay In order to verify whether the binding of Sp1 and Sp3 proteins to the AbH-J-J P1 promoter occurs ... functional characterization of the P1 promoter of the AbH-J-J locus demonstrate that this belongs to the class of Sp1 -controlled pr...

Ngày tải lên: 23/03/2014, 07:20

... pages doi:10.1155/2008/875351 Research Article Adaptive Kernel Canonical Correlation Analysis Algorithms for Nonparametric Identification of Wiener and Hammerstein Systems Steven Van Vaerenbergh, Javier V ´ ıa, and Ignacio ... can be done, for instance, by introducing a forgetting factor. In this section, we discuss an adaptive version of kernel CCA which...

Ngày tải lên: 21/06/2014, 22:20

... Genetic Algorithms for Contrast and Entropy Optimization in ISAR Autofocusing Marco Martorella, Fabrizio Berizzi, and Silvia Bruscoli Department of Information Engineering, University of Pisa, Via ... Eng ineering (EEE) of the University of Adelaide under a postdoctoral contract, and the Department of Information Tech- nology and Electrical Engineering (ITEE)...

Ngày tải lên: 22/06/2014, 23:20

... purposes) Genome Biology Open Access Method A blind deconvolution approach to high-resolution mapping of transcription factor binding sites from ChIP-seq data Desmond S Lun * , Ashley Sherrid †‡ , Brian ... locations of transcription factor binding from ChIP-seq data. CSDeconv differs from prior methods in that it uses a blind deconvolution approac...

Ngày tải lên: 09/08/2014, 20:21

... and u se information stored in genome databases, is an essential part of genomic and bioinformatic analysis [1-4]. While now primarily a basic research tool, analysis of genome annotation information ... Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors. Journal of...

Ngày tải lên: 10/08/2014, 09:22

... the binding of transcription factors (proteins) to cognate sites on a chromosome (tran- scription factor binding sites) . For a given transcription factor and an experimentally identified set of ... for transcription factor binding sites is reduced. A search of such a reduced database in and of itself will allow the detection of more statistically significant...

Ngày tải lên: 12/08/2014, 17:20

... in the number of binding sites or in the affinity of a binding site results in an increase of the Hill coefficient. This effect becomes stronger if the affinity of one of the binding sites is increased ... potential transcription factor binding sites in the Hes7 promoter [4], so why are no more than two of them active? ã Our numerical analysis...

Ngày tải lên: 13/08/2014, 23:20

... greatly increases the specificity and selectivity of CRM searches based on binding-site clusteringFigure 5 Inclusion of evolutionary information greatly increases the specificity and selectivity of ... identification of developmental enhancers: conservation and function of transcription factor binding-site clusters in Drosophila melanogaster and D...

Ngày tải lên: 14/08/2014, 14:21

... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA YLR387C_Skud AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA YLR387C_Sbay AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT ... region. YLR387C_Scer AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA YLR387C_Spar AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...

Ngày tải lên: 14/08/2014, 14:21

... experimentally, for example by binding site selection [29] or by computa- tional analysis of co-regulated genes [2,30,31], or by a combi- nation of selection and computational analysis [23]. Typically, ... cooperative binding of proteins X and Y to DNA can be separated thermodynamically into the formation of an XY dimer and the binding of that dimer to DNA; this is the...

Ngày tải lên: 14/08/2014, 14:22

... BarkaiVolume 6, Issue 12, Article R103 Research The design of transcription-factor binding sites is affected by combinatorial regulation Yonatan Bilu * and Naama Barkai *† Addresses: * Department of Molecular ... number of binding sites, and the gene promoters that are most amenable to the addition or deletion of binding sites. Based on this analysis, we sugges...

Ngày tải lên: 14/08/2014, 15:20

... thank Yael Berstein and Yonina Eldar for advice on sta- tistical analysis and mathematical formulations. This work was supported by the Mallat Family Fund granted to YMG. HDE was supported by ... in Additional data file 4 as a standalone download suitable for running under the Linux OS. Abbreviations AA: alternative acceptor; AD: alternative donor; AS: alterna- tive splicing; CE: casse...

Ngày tải lên: 14/08/2014, 21:20

... Forward TAATGCT b0904 focA ATATCAA [63] 1 +1 Forward TATCAAT b0904 focA CAACTCA [63] 1 +1 Forward AACTCAT b0904 focA CATTAAT [63] 1 +1 Reverse TATTAAT b0904 focA GATCGAT [63] 1 +1 Reverse TATCGAT b0904 ... NarL Original sequence logo weblogo.berkeley.edu 0 1 2 bits 5 1 G A T 2 C G A T 3 C A G 4 T C A 5 C G A T 6 7 T 8 C T A 9 10 C G T A 11 C G A T 12 T A C 13 C T G A 14 C...

Ngày tải lên: 14/08/2014, 21:20

... Algorithms for Representation and Discovery of Transcription Factor Binding Sites Elena Zaslavsky A Dissertation Presented to the Faculty of Princeton University in Candidacy for the Degree of ... far the poorest performance of all basic methods in discriminating between binding sites for the transcription factor of interest and binding sites of...

Ngày tải lên: 13/11/2014, 09:10

Ngày tải lên: 13/11/2014, 09:56