...
Ngày tải lên: 06/03/2014, 15:20
...
Ngày tải lên: 06/03/2014, 15:20
Báo cáo khoa học: The stop transfer sequence of the human UDPglucuronosyltransferase 1A determines localization to the endoplasmic reticulum by both static retention and retrieval mechanisms docx
... fusion of UGT1A stop transfer sequence (TMD ⁄ CT) with the ectodomain of the plasma membrane CD4 reporter protein. We showed that the stop transfer sequence, when attached to C-terminus of the CD4 ... investigated the mechanism of ER residency of UGT1A mediated by the stop transfer sequence by analysing the subcellular localization and sensit...
Ngày tải lên: 07/03/2014, 16:20
The Benefits and Costs of the Clean Air Act from 1990 to 2020: U.S. Environmental Protection Agency Office of Air and Radiation potx
... The Benefits and Costs of the Clean Air Act fron 1990 to 2020 3-1 CHAPTER 3 - DIRECT COSTS The costs of complying with the requirements of the Clean Air Act Amendments (CAAA) of 1990 ... exceeded costs by a factor of 10 to 100. A second Section 812 report, The Benefits and Costs of the Clean Air Act: 1990 to 201...
Ngày tải lên: 15/03/2014, 16:20
Báo cáo khoa học: Response of the Pacific oyster Crassostrea gigas to hypoxia exposure under experimental conditions pot
... 2005) doi:10.1111/j.1742-4658.2005.04960.x The molecular response to hypoxia stress in aquatic invertebrates remains relatively unknown. In this study, we investigated the response of the Pacific oyster Crassostrea gigas to hypoxia under ... FEBS Response of the Pacific oyster Crassostrea gigas to hypoxia exposure under experimental condit...
Ngày tải lên: 16/03/2014, 23:20
how the use of the diary form narrative is beneficial to the
... How the use of the diary form narrative is beneficial to the novel Dracula. Bram Stoker, being the creative and intellectual writer himself, wrote the novel Dracula in the diary form of narrative. ... narrative. This was a good choice of how to write the novel since it was very beneficial to the plot of Dracula. Examples of how the...
Ngày tải lên: 21/03/2014, 22:04
The Food of the Gods and How It Came to Earth pot
... fields of the Hickleybrow glebe, and finally, when that squealing began, took the line of least resistance out of his perplexities into the Incognito. And in the Incognito, whether of this or of some ... the things at the back of the bar and the other fixed on the Absolute, missed the psychological moment. “I thuppothe there ’athen’t been any trouble with...
Ngày tải lên: 22/03/2014, 23:20
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAA...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot
... FEBS 399 Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation Francisco A. In ˜ esta-Vaquera 1 , Francisco Centeno 2 , ... E-cadherin or other protein(s) in the hDlg complex under stressful conditions, and the cortical cytoskeleton is therefore disrupted and hD...
Ngày tải lên: 23/03/2014, 06:20
Environmental Impact of Products (EIPRO) Analysis of the life cycle environmental impacts related to the final consumption of the EU-25 pot
... However, the EUR 22284 EN Environmental Impact of Products (EIPRO) Analysis of the life cycle environmental impacts related to the final consumption of the EU-25 Main report IPTS/ESTO project By: Arnold ... percentage of the EU-25 total for each impact category. Reliability of the model The study shows that the top-down IO approach i...
Ngày tải lên: 23/03/2014, 08:21
Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx
... the other hand, the importin a family generally binds to both the nuclear import cargo and importin b, indicating that importin a functions as an adaptor between the cargo proteins and importin ... The Authors Journal compilation ª 2011 FEBS Targeted disruption of one of the importin a family members leads to female functional incompeten...
Ngày tải lên: 28/03/2014, 23:20
led zeppelin. the origin of the species how, why and where it all began
... 11:11:34 LED ZEPPELIN The Origin Of The Species lz054.indd 1lz054.indd 1 26/04/2006 11:11:3326/04/2006 11:11:33 35 THE ORIGIN OF THE SPECIES Ravens, The Barron-Knights - and Johnny Kidd and the ... as the lz054.indd 35lz054.indd 35 26/04/2006 11:11:3826/04/2006 11:11:38 49 THE ORIGIN OF THE SPECIES - with hired hands quicker off the mark. The...
Ngày tải lên: 04/06/2014, 15:26
empires of belief - why we need more scepticism and doubt in the 21th century
... philosophy in the West increasingly being drawn into the web of Christian theology and made to serve its more specialised interests (enquiries into the nature of God and his prop- erties, proofs for the ... standard by hypothesis, and if they want to judge the standard by a standard we throw them into an in nite regress. Again, since a proof needs a standard which h...
Ngày tải lên: 05/06/2014, 11:25
rebonato - plight of the fortune teller; why we need to manage financial risk differently (2007)
... Plight of the Fortune Tellers Plight of the Fortune Tellers Why We Need to Manage Financial Risk Differently Riccardo Rebonato PRINCETON UNIVERSITY PRESS PRINCETON AND OXFORD Copyright ... have professional, and often quantitative, financial risk managers in mind. But I also intend to speak to their managers (and to the managers of their managers),...
Ngày tải lên: 01/11/2014, 12:20