Mobilizing capital of enterprises on securities market of vietnam
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... vital when buying low involvement product. 19 A STUDY TO INDICATE THE IMPORTANCE OF CONSUMER BASED -BRAND EQUITY ON CONSUMER PERCEPTION OF BRAND (A CASE STUDY OF FAST FOOD RESTAURANTS) Master ... enhances the consumer s knowledge and awareness of the available brand. ã Alternative evaluation: this is the stage whereby the consumers e...
Ngày tải lên: 24/09/2012, 17:19
Báo cáo y học: "Effect of antibodies on the expression of Plasmodium falciparum circumsporozoite protein gene"
... circulating blood. This study sets to understand the role of anti -Plasmodium antibodies on the erythrocytic development of Plasmodium falciparum and their effect on the expression of csp gene. 2. Materials ... involved indirectly on erythrocyte invasion. The immune localisation of the CS-like protein described by Cochrane et al. [12] only found at the...
Ngày tải lên: 02/11/2012, 10:14
A study on cognitive metaphors of negative emotions in english and vietnamese
... sadness metaphors that exist in English are also applicable in Vietnamese. Data analyzed show that the two languages share the same conceptualization and language manifestation in most metaphors. ... in a certain kind of habitat, are familiar with things and phenomena that are characteristic of that habitat; and they will make use of them for the metaphorical co...
Ngày tải lên: 26/11/2013, 13:17
A STUDY ON THE TRANSLATION OF ACCOUNTING TERMS FROM ENGLISH INTO VIETNAMESE
... learners enlarge their vocabulary and have general understanding about translation and translation of financial and accounting terms. All of English and Vietnamese terms in my graduation paper ... of the study 21 CHAPTER 2: AN INVESTIGATION ON ACCOUNTING TERMS AND THEIR VIETNAMESE EQUIVALENT. I. The popular construction of accounting terms Th...
Ngày tải lên: 11/12/2013, 23:53
A STUDY ON THE TRANSLATION OF WEATHER TERMS FROM ENGLISH INTO VIETNAMESE
... qualification, " ;weather& quot; is understood to be the weather of Earth. (http://en.wikipedia.org/wiki /Weather) 5.2 Weather terms Weather terms that describe weather under a number of ... Faithfull translation The translation reproduces the exact contextual meaning of the original within the constraints of the grammatical structure of the TL....
Ngày tải lên: 11/12/2013, 23:55
Tài liệu PEPFAR Guidance on Integrating Prevention of Mother to Child Transmission of HIV, Maternal, Neonatal, and Child Health and Pediatric HIV Services pdf
... integrated PEPFAR Guidance on Integrating Prevention of Mother to Child Transmission of HIV, Maternal, Neonatal, and Child Health and Pediatric HIV Services Objectives of the Guidance Supporting ... integration of Prevention of Mother to Child Transmission (PMTCT) and pediatric HIV with Maternal, Neonatal, and C...
Ngày tải lên: 12/02/2014, 19:20
Tài liệu Impact of Culture on Depressive Symptoms of Elderly Chinese Immigrants doc
... Journal of Psychiatry—Original Research Original Research Impact of Culture on Depressive Symptoms of Elderly Chinese Immigrants Daniel WL Lai, PhD 1 Key Words: depression, elderly Chinese immigrants, ... Ageline resulted in over 150 research publications on depression among elderly Chinese as of January 1, 2003. Among them, only 7 studies examined depressi...
Ngày tải lên: 14/02/2014, 06:20
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf
... programs of the armed forces. Accurate data on the relationship between performance on the one hand and ability, experience, and training on the other would allow military officials to determine ... Determinants of Productivity for Military Personnel A Review of Findings on the Contribution of Experience, Training, and Aptit...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F...
Ngày tải lên: 18/02/2014, 11:20
Research report: "To study the effect of substituents on the properties of aniline by the method of approximate quantum AM1" pps
... 82 bond length. Also, the pKa of the amino nitrogen is increased by electron-donating substituents. The variations of the three properties are closely tied together. Hammett σ constants ... 77 Studying substituent effects on the properties of aniline with approximate quantum chemistry method AM1 Truong Van Nam (a) , Nguyen Xuan Dung (a) Abstract....
Ngày tải lên: 23/07/2014, 13:21
Báo cáo lâm nghiệp: "Improving RBS estimates – effects of the auxiliary variable, stratification of the crown, and deletion of segments on the precision of estimate" pps
... variables, the stratification of the crown and the deletion of segments. In the present study, the effects of the choice of the auxiliary variable and of the created crown structure (segments and nodes, ... dele- tion of the stem segments. After this closer look at the old pine, the effect of stratification and deletion of the stem seg...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo sinh học: " Effects of the number of markers per haplotype and clustering of haplotypes on the accuracy of QTL mapping and prediction of genomic breeding values" pot
... purposes) Genetics Selection Evolution Open Access Research Effects of the number of markers per haplotype and clustering of haplotypes on the accuracy of QTL mapping and prediction of genomic breeding values Mario ... Roel.Veerkamp@wur.nl * Corresponding author Abstract The aim of this paper was to compare the effect of haplotype defin...
Ngày tải lên: 14/08/2014, 13:21
level of autonomy on the management of vocational schools in hanoi city, vietnam
... Distribution of Responses on the existing level of autonomy on management of Vocational schools in Hanoi city in terms of to Identifying of Organizational autonomy 61 4.2.4 Mean Distribution of ... schools in Hanoi city in terms of to Identifying of Financial autonomy 73 4.2.7 Mean Distribution of Responses on the existing level...
Ngày tải lên: 23/08/2014, 01:58
Mobilizing capital of enterprises on securities market of vietnam
... organizations. CHAPTER 2 REAL STATE OF CAPITAL MOBILIZATION OF ENTERPRISES IN VIETNAM SECURITIES MARKET 2.1. FORMATION AND DEVELOPMENT OF VIETNAM SECURITIES MARKET 2.1.1. Formation process of ... 2.2.3. Result of capital mobilization of enterprises in Vietnam securities market * Statistics of results of capital mobilization in Vietnam s...
Ngày tải lên: 27/10/2014, 11:35
Mobilizing capital of enterprises on securities market of vietnam
... organizations. CHAPTER 2 REAL STATE OF CAPITAL MOBILIZATION OF ENTERPRISES IN VIETNAM SECURITIES MARKET 2.1. FORMATION AND DEVELOPMENT OF VIETNAM SECURITIES MARKET 2.1.1. Formation process of ... 2.2.3. Result of capital mobilization of enterprises in Vietnam securities market * Statistics of results of capital mobilization in Vietnam s...
Ngày tải lên: 27/10/2014, 13:11