design and construction of circular wire- and strand-wrapped

Introductions and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific

... Mainland China (FAO correspondent). Of these first trials, only Mainland China maintained production and started an industry. In 1988, a batch of P. vannamei PL were introduced into Mainland ... billion 2 in 2002. P. vannamei was introduced into Asia experimentally from 1978-79, but commercially only since 1996 into Mainland China and Taiwan Province of China, follow...

Ngày tải lên : 14/03/2014, 11:18

99
805
0

API 2510 – 2001 design and construction of LPG installations

... 15 minutes of fire exposure. This may require fireproofing of the control DESIGN AND CONSTRUCTION OF LPG INSTALLATIONS 3 4 Design of LPG Vessels 4.1 APPLICABLE DESIGN CONSTRUCTION ... Standards Body: e API 2510: Design and Construction of LPG Installations 49 CFR 195.205(b)(3) American Petroleum Institute 22 API STANDARD 2510 flexibil...

Ngày tải lên : 27/03/2014, 14:08

29
1.7K
1

Báo cáo khoa học: Thermal unfolding and aggregation of actin Stabilization and destabilization of actin ﬁlaments doc

... whereas opening of the cleft leads to significant destabilization of G -actin. Thermal unfolding of F -actin filaments Polymerization of G -actin to F -actin The use of DSC allows very clear probing of the changes ... ARTICLE Thermal unfolding and aggregation of actin Stabilization and destabilization of actin filaments Dmitrii I. Levitsky 1,2 ,...

Ngày tải lên : 30/03/2014, 04:20

16
488
0

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... gene and 3Â end of a signal peptide: 5Â-CAGAAGCGGAA GAAA GCATGCAAAGGCAGA-3Â (number 2), were used. In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene. Two others: forward 5Â-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3Â and reverse 5Â-AATTCTCATTA CTACCTCTGCG...

Ngày tải lên : 30/03/2014, 13:20

10
696
0

Báo cáo hóa học: " Research Article Real-Time Transmission and Storage of Video, Audio, and Health Data in Emergency and Home Care Situations" pdf

... pages doi:10.1155/2007/67818 Research Article Real-Time Transmission and Storage of Video, Audio, and Health Data in Emergency and Home Care Situations Ivano Barbieri, Paolo Lambruschini, Marco Raggio, and Riccardo Stagnaro Department ... S. Andreou, C. Pattichis, and C. Schizas, “Multipurpose health care telemedicine system,” in Proceedings of th...

Ngày tải lên : 22/06/2014, 19:20

7
358
0

Báo cáo y học: "Strong inhibition of TNF-α production and inhibition of IL-8 and COX-2 mRNA expression in monocyte-derived macrophages by RWJ 67657, a p38 mitogen-activated protein kinase (MAPK) inhibitor" ppt

... signifi- cantly inhibited at nanomolar concentrations of RWJ 67657, and mRNA expression was also decreased, by nearly 50% at 10 nM. Inhibition of p38 MAPK activity leads to reduced TNF-α mRNA expression ... biosynthesis. Nat Cell Biol 1999, 1:94-97. 21. Bhattacharyya A, Pathak S, Datta S, Chattopadhyay S, Basu J, Kundu M: Mitogen-activated protein kinases and...

Ngày tải lên : 09/08/2014, 01:23

9
317
0

Báo cáo khoa học: " Inverse planned stereotactic intensity modulated radiotherapy (IMRT) in the treatment of incompletely and completely resected adenoid cystic carcinomas of the head and neck: initial clinical results and toxicity of treatment" potx

... Access Research Inverse planned stereotactic intensity modulated radiotherapy (IMRT) in the treatment of incompletely and completely resected adenoid cystic carcinomas of the head and neck: initial clinical ... Corresponding author Abstract Background: Presenting the initial clinical results in the treatment of complex shape...

Ngày tải lên : 09/08/2014, 10:21

6
471
0

Báo cáo y học: "Acral lentiginous melanoma of the foot and ankle: A case series and review of the literature" pps

... purposes) Journal of Foot and Ankle Research Open Access Research Acral lentiginous melanoma of the foot and ankle: A case series and review of the literature Ivan R Bristow* 1 and Katharine Acland 2 Address: ... superficial spreading melanoma (SSM), nodular melanoma (NM) and lentigo maligna melanoma (LMM). In 1976, a fourth type, acral lentigin...

Ngày tải lên : 10/08/2014, 21:23

5
439
0

báo cáo khoa học:" Salivary flow rate, pH, and concentrations of calcium, phosphate, and sIgA in Brazilian pregnant and non-pregnant women" pdf

... lower salivary flow rates in pregnant women compared with non -pregnant women Table 1: Salivary flow rate, pH, and concentrations of calcium, phosphate, and sIgA in pregnant and non -pregnant women. Variable ... Medicine Open Access Research Salivary flow rate, pH, and concentrations of calcium, phosphate, and sIgA in Brazilian...

Ngày tải lên : 11/08/2014, 23:22

5
327
0

Technical manual for design and construction of road tunnels civil elements

... and Subtitle 5. Report Date December 2009 6. Performing Organization Code TECHNICAL MANUAL FOR DESIGN AND CONSTRUCTION OF ROAD TUNNELS – CIVIL ELEMENTS 7. Author(s) 8. Performing ... single-source technical manual providing guidelines for planning, design, construction and rehabilitation of road tunnels, and encompasses various types...

Ngày tải lên : 30/08/2014, 22:32

702
828
0

BS 5588 4 1978 fire precautions in the design and construction of buildings MVAC

... Copy, â BSI BS 5588- 4: 1978 ii â BSI 01-1999 Foreword This new code of practice was prepared under the direction of the Fire Standards Committee. In addition to the existing BS 5588- 1.1, BS 5588- 2, ... the release of the pressurizing air. In buildings having an arrangement for the release of the pressurizing air that relies on the automatic op...

Ngày tải lên : 28/09/2014, 23:27

46
827
2

BS 5588 4 1978 fire precautions in the design and construction of buildings—MVAC

... fire. BS 5588, Fire precautions in the design and construction of buildings. BS 5588- 1, Residential buildings. BS 5588- 1.1, Code of practice for single-family dwelling houses 3) . BS 5588- 1.2, ... use of adhesive tape should not be relied upon for the long-term sealing of ducts. The layout of the ductwork and the sizing of the main duct or...

Ngày tải lên : 28/09/2014, 23:27

46
926
3

BS 5588 5 1991 fire precautions in the design and construction of buildings firefighting

... clause38 of BS5 306-1:1976), and inspection of the firefighting lift (seeBS5 655 -10). e) Annually, operational testing of the firefighting lift controls as described inC.1, and verification of the ... recommended in BS5 58 8-1. d) Where the firefighting shaft contains a firefighting lift, the firefighting shaft should contain a fire main. e) Firefig...

Ngày tải lên : 28/09/2014, 23:28

44
540
0

design and construction of circular prestressed concrete structures with circumferential tendons

... 2—Materials, p. 373R-97-5 2.1 Concrete 2.2—Shotcrete and filler materials 2.3—Admixtures Design and Construction of Circular Prestressed Concrete Structures with Circumferential Tendons Reported by ... the wall. 1.2—Objective The objective of this report is to provide guidance in the design and construction of circular prestressed concrete structure...

Ngày tải lên : 24/10/2014, 17:26

26
645
0

design and construction of circular wire- and strand-wrapped prestressed concrete structures

... A—Recommendations and considerations related to the design and construction of tank foundations, p. 372R-20 CHAPTER 1—GENERAL 1.1—Introduction The design and construction of circular prestressed concrete structures ... concrete and prestressed concrete design and construction given in ACI 318-99, ACI 350-01, and ACI 301. Design and construction...

Ngày tải lên : 24/10/2014, 17:26

24
493
0