... Journal of Mathematical Analysis and Ap- plications 318 (2006), no. 1, 63–76. [7] M. Kipnis and R. M. Nigmatulin, Stability of trinomial linear difference equations w ith two delays, Automation and ... the stability of solutions of certain linear differential equations with a lagging argument in the Banach space, Doklady Akademii Nauk SSSR 111 (1956), 770–773 (Russian). Mikhail Ki...
Ngày tải lên: 22/06/2014, 22:20
cross-sectional stability of a two-inlet bay system
... model for the two-inlet bay system is validated using information on Matagorda Bay in Texas, U.S .A. 4.2 One-inlet bay system Assume that the water level inside the bay fluctuates uniformly, ... investigate the stability behaviour of a two-inlet bay system. In the previous section it was clear that the equilibrium flow areas (A 1 , A 2 ) cannot be obtained anal...
Ngày tải lên: 03/10/2014, 13:13
... RESEARCH Open Access Stability of a nonlinear non-autonomous fractional order systems with different delays and non-local conditions Ahmed El-Sayed 1* and Fatma Gaafar 2 * Correspondence: amasayed5@yahoo.com 1 Faculty ... non-negative solu- tion and the stability and asymptotic properties of the solution of fractional differential dynamic systems involving delayed dynamics with po...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article Lagrangian Stability of a Class of Second-Order Periodic Systems" docx
... pages doi:10.1155/2011/845413 Research Article Lagrangian Stability of a Class of Second-Order Periodic Systems Shunjun Jiang, Junxiang Xu, and Fubao Zhang Department of Mathematics, Southeast University, Nanjing 210096, ... The idea is also to change the original problem to Hamiltonian system and then use a twist theorem of area-preserving mapping to the Pioncar ´ emap. The a...
Ngày tải lên: 21/06/2014, 07:20
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... in nature to a data manager which fails to free data, but is easier to detect and prevent. • Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... data. It is usually made in response to a pager_data_request call made to the data manager by the kernel. Typical data managers will only provide data upon demand (when processing pa...
Ngày tải lên: 12/09/2012, 15:05
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 A...
Ngày tải lên: 16/03/2014, 01:20
The Design and Implementation of a Sequence Database System * docx
... object-relational database system Illustra [I11941 provides database support for time-series data along with relational data. A time-series is an ADT(Abstract Data Type) value implemented a& amp; a large ... Catalog Management: Each E-ADT can provide catalogs that maintain statistics and store schema information. Further, certain values may be named. Query Language: An E-ADT c...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx
... transfer-based MT system, actual trans- lation takes place in transfer and can be descri- bed as the ocr~putaticnal manipulation of tree structures. In the absenoe of any formal theory of translation ... This software tool not only allows for the separation of data and algorithms but also provides great flexibility in the organization of grammars and subgrammars, and in the...
Ngày tải lên: 17/03/2014, 19:21
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... not readily available (Zhao et al., 2010). In contrast, bilingual parallel data is in abundance and has been used in extracting paraphrase (Ban- nard and Callison-Burch, 2005; Zhao et al., 2008b; Callison-Burch, ... issues are also raised in (Zhao and Wang, 2010) about using automatic metrics: paraphrase changes less gets larger BLEU score and the evaluations of paraphrase quality and rate...
Ngày tải lên: 23/03/2014, 14:20
Measuring the Economic Value of a City Park System docx
... First, land cover data are obtained through analysis of aerial photographs. This reveals forested as well as open grassy areas and also water surface; it also reveals impervious surfaces in parks—roadways, ... D.C.’s Parks Value of properties within 500 feet of parks Assumed average value of a park Value of properties attributed to parks Effective annual residential tax rate Ann...
Ngày tải lên: 02/04/2014, 08:20