anshcpu anacpu anucpu qcpu a a mode dedicated

... available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor do they parallel the findings on the noncanonical class IIIc AC Rv1900c [14]. Another ... non- conservative manner, glutamine-asparagine instead of lysine-aspartate. All mammalian membrane-bound ACs possess a strictly conserved and spaced hexad of catalytic residues. Emer...

Ngày tải lên: 07/03/2014, 21:20

... influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table 1 and remain invariable all the rest of parameters. The obtained results are shown ... Abstract. Solving the system of equations describing the stationary operation of a two -mode random microlaser we have found the transformation of saturated values of mode intensity when...

Ngày tải lên: 14/03/2014, 13:20

... RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTA TTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢). RTEAyF was designed as such that restriction of the generated tatAyCy–strep PCR-ampli- fied fragment ... found that the TatAdCd pathway was active in an E. coli background and able to translocate the E. coli Tat substrate TMAO reductase (TorA) [21]....

Ngày tải lên: 16/03/2014, 04:20

... purification and crystallization Z. ramigera thiolase and its C8 9A mutant were expressed and purified as previously described [2,9]. Crystallization of wild-type thiolase and its C8 9A variant were carried ... of substrate in the thiolase catalytic pocket. Furthermore, calorimetric assays indicate that the mutation of Cys89 into an alanine significantly decreases the affinity of thiolase towar...

Ngày tải lên: 16/03/2014, 04:20

... the larger and richer knowledge domains which have to be handled. The main conclusion of the paper is that the notions of processing capacity, memory constraints and control structure are ... rehension strategies and orders the vehicle expansion and matching processes. 3. COMPARISON WITH OTHER THE?RIES The paper compares the model of metaphor comp- rehension with established theories...

Ngày tải lên: 17/03/2014, 19:20

... for international magazines and newspapers as a freelance journalist. He employed this combination of practical and academic experiences to a variety of consultancies for major corporations. ... Multi-Hop Relay Node, by Employing Half-Duplex Mode Jaafar Adhab AL-Dhaibani 1 , A. Yahya 2 , R.B. Ahmed 3 , and A. S. Md Zain 4 1,2,3,4 School of Computer and Communication Engi...

Ngày tải lên: 09/07/2014, 08:10

... genes having multiple anno- tations. For instance, a particular GoSlim molecular function gene may be annotated as both a transferase and a protein kinase. In enumerating a specific network pattern, ... Bhamidipati A, Punna T, Ihmels J, Andrews B, Boone C, Greenblatt JF, et al.: Explo- ration of the function and organization of the yeast early secretory pathway through an epistatic...

Ngày tải lên: 14/08/2014, 08:20

... trưởng Richard Causay c a Enron nguyên làngười c a Andersen. Giám đốc Tài chính c a Enron trước Andrew Fastow là Jeffrey McMahon nguyên cũng từ Andersen chuyển sang. Ngoài ra công ty Andersen đã ... toán tài chính (Financial Statements Audit) >Kiểm toán tuân thủ (Compliance Audit) >Kiểm toán hoạt động (Operational Audit) 2.1.1. Kiểm toán tài chính (Financial Statements Audit): 2...

Ngày tải lên: 27/10/2012, 16:34