settlement of a strikes by collective bargaining and mediation under vietnamese law- in comparision with the swedish system

settlement of a strikes by collective bargaining and mediation under vietnamese law- in comparision with the swedish system

settlement of a strikes by collective bargaining and mediation under vietnamese law- in comparision with the swedish system

... nations, including Sweden, collective bargaining may be mandatory. Generally, the settlement of a strike by collective bargaining has been recognized by the labour law of Vietnam but without any ... at the stage of collective bargaining. With a mechanism in which there is participation by the two parties only, collective bargaining depends on the...

Ngày tải lên: 18/08/2014, 12:36

72 310 0
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa tttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and de...

Ngày tải lên: 11/08/2014, 11:21

14 400 0
Báo cáo y học: "Utilization of outpatient services in refugee settlement health facilities: a comparison by age, gender, and refugee versus host national status" ppt

Báo cáo y học: "Utilization of outpatient services in refugee settlement health facilities: a comparison by age, gender, and refugee versus host national status" ppt

... Bangladesh, Tanzania, Rwanda, Yemen and Zambia had an average under- five refugee population greater than 19%, while Nepal and Sudan had rates as low as 8-9%. National estimates of the size of the under- five ... national estimates of the size of the female population for host countries. Asian and African countries included in the database, on average, have about...

Ngày tải lên: 13/08/2014, 15:21

15 193 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

... Immunoblot analyses showed a progressive loss of intact ETA and ETA -A in the presence of ATP, with concomitant generation of ETA and ETA -A fragments. Incubation in the absence of ATP revealed a small amount ... intrinsic apoptosis at a late stage of ETA infection, as assessed by the mitochondrial release of cytochrome c, caspase-9 and caspase-3 activa...

Ngày tải lên: 18/02/2014, 04:20

15 588 0
Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx

Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx

... number of cases and financial constraints. Ethical Approval The study was approved by the institutional ethics committee of TN Medical College and BYL Nair Charitable Hospital, Mumbai, India. ... currently available to detect AFB in clinical samples by ZN staining. As seen in Table 1, 80 % of the samples showed the presence of AFB in the primary smear....

Ngày tải lên: 15/03/2014, 03:20

6 466 1
step-by-step installation of a secure linux web, dns, and mail server 2004

step-by-step installation of a secure linux web, dns, and mail server 2004

... go into a lot of details on the installation of the core Openna system. The installation is fairly self explanatory and there is excellent documentation at 4 . I always chose to manually partition ... experience with the creator of Openna Linux – Gerhard Mourani. Gerhard has written several books on securing and optimizing RedHat Linux and Openna Linux which the au...

Ngày tải lên: 24/04/2014, 09:18

74 437 0
Báo cáo y học: "A genomic view of methane oxidation by aerobic bacteria and anaerobic archaea" doc

Báo cáo y học: "A genomic view of methane oxidation by aerobic bacteria and anaerobic archaea" doc

... research interactions information refereed research Minireview A genomic view of methane oxidation by aerobic bacteria and anaerobic archaea Ludmila Chistoserdova*, Julia A Vorholt † and Mary ... have rings of pMMO-harboring membranes at the periphery of the cells, and use the serine cycle, an alternative pathway for converting formaldehyde into biomass; these bacteri...

Ngày tải lên: 14/08/2014, 14:21

6 213 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Management Framework - Introd uced Marine Pests Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the ... have a role in liaising with IMO, FAO, NACA to enhance the effectiveness of existing instruments within APEC  Institutional arrangements for managing the marine environmen...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Tài liệu The message of a master - By John McDonald pdf

Tài liệu The message of a master - By John McDonald pdf

... destructively, or partially so, and the scales are balanced against them. Here and there, among the masses, we find an occasional outstanding figure who has achieved greatness or success and he is ... it withers away. If all goes well, it blossoms forth and, having reached its goal, a seed is again dropped and the process repeated. Bear in mind that the actual proces...

Ngày tải lên: 15/12/2013, 06:15

50 862 0
w