settlement of a strikes by collective bargaining and mediation under vietnamese law- in comparision with the swedish system
settlement of a strikes by collective bargaining and mediation under vietnamese law- in comparision with the swedish system
... nations, including Sweden,
collective bargaining may be mandatory.
Generally, the settlement of a strike by collective bargaining has been recognized by the
labour law of Vietnam but without any ... at the stage of collective
bargaining. With a mechanism in which there is participation by the two parties only, collective
bargaining depends on the...
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx
... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa
tttgag
G K Q V K M M L E K Q L K S N Q K
721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat
781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt
841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt
841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa
Figure 3 Full-length cDNA and de...
Báo cáo y học: "Utilization of outpatient services in refugee settlement health facilities: a comparison by age, gender, and refugee versus host national status" ppt
... Bangladesh, Tanzania,
Rwanda, Yemen and Zambia had an average under- five
refugee population greater than 19%, while Nepal and
Sudan had rates as low as 8-9%. National estimates of
the size of the under- five ... national
estimates of the size of the female population for host
countries. Asian and African countries included in the
database, on average, have about...
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc
... Immunoblot analyses
showed a progressive loss of intact ETA and ETA -A
in the presence of ATP, with concomitant generation
of ETA and ETA -A fragments. Incubation in the
absence of ATP revealed a small amount ... intrinsic apoptosis at a late stage of ETA infection, as assessed by
the mitochondrial release of cytochrome c, caspase-9 and caspase-3 activa...
Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx
...
number of cases and financial constraints.
Ethical Approval
The study was approved by the institutional
ethics committee of TN Medical College and
BYL Nair Charitable Hospital, Mumbai, India. ...
currently available to detect AFB in clinical
samples by ZN staining. As seen in Table 1, 80
% of the samples showed the presence of AFB
in the primary smear....
step-by-step installation of a secure linux web, dns, and mail server 2004
... go into a lot of details on the installation of the core Openna system. The
installation is fairly self explanatory and there is excellent documentation at
4
. I always
chose to manually partition ... experience with the creator of Openna Linux – Gerhard Mourani. Gerhard has
written several books on securing and optimizing RedHat Linux and Openna Linux
which the au...
Báo cáo y học: "A genomic view of methane oxidation by aerobic bacteria and anaerobic archaea" doc
... research
interactions
information
refereed research
Minireview
A genomic view of methane oxidation by aerobic bacteria and
anaerobic archaea
Ludmila Chistoserdova*, Julia A Vorholt
†
and Mary ... have rings of pMMO-harboring membranes
at the periphery of the cells, and use the serine cycle, an
alternative pathway for converting formaldehyde into
biomass; these bacteri...
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Management Framework - Introd
uced Marine Pests
Priorities and hazards for
Economies
Variable levels of activity and
management capability
Ships’ ballast water and hull
fouling are the ... have a role in liaising
with IMO, FAO, NACA to enhance the
effectiveness of existing instruments within
APEC
Institutional arrangements for managing the
marine environmen...
Tài liệu The message of a master - By John McDonald pdf
... destructively, or partially so, and the
scales are balanced against them. Here and there, among
the masses, we find an occasional outstanding figure who
has achieved greatness or success and he is ... it withers away. If all goes well, it
blossoms forth and, having reached its goal, a seed is again
dropped and the process repeated. Bear in mind that the
actual proces...