249 Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage doc

249. Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage doc

249. Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage doc

... like like." AL ROKER: "Do you like like? So what's the word like in German?" Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage 09 May 2006 AA: I'm Avi ... word like has gone from California slang to worldwide phenomenon." CARMEN FOUGHT: " ;Like is what we call a discourse marker, which means, like...
Ngày tải lên : 14/08/2014, 21:21
  • 4
  • 286
  • 0
Báo cáo toán học: "VEGF T-1498C polymorphism, a predictive marker of differentiation of colorectal adenocarcinomas in Japanese" docx

Báo cáo toán học: "VEGF T-1498C polymorphism, a predictive marker of differentiation of colorectal adenocarcinomas in Japanese" docx

... FAM-CCAACgCCCTCAAC C-7T Forward primer CCGAGCCGGAGAGGGA Reverse primer GCACCCAAGACAGCAGAAAGT C -7 -allele probe VIC-CATGGTTTCgGAGGCC T -7 -allele probe FAM-ATGGTTTCaGAGGCC Effect of NaB ... Kuwahara 1 , Koichi Iwaki 1 , Takao Tamura 4 , Nobuo Aoyama 5 , Svetlana Markova 2 , Masato Kasuga 4 , Katsuhiko Okumura 1, 2, 3 , Toshiyuki Sakaeda 2, 6 1. Department of Hospital Pharmacy...
Ngày tải lên : 08/08/2014, 17:20
  • 7
  • 243
  • 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc

The 1998 bleaching event and its aftermath on a coral reef in Belize doc

... representation and as propor- tional covers for statistical analysis. Repeated-measures analysis of variance (ANOVA) was used to compare the proportional covers of individual substrate components among ... Cay did not perform appreciably better in comparison with daily means of in situ data than did Day or combined Day+Night SST data. Additional information on the performance of the Pathfi...
Ngày tải lên : 07/03/2014, 17:20
  • 13
  • 583
  • 0
Báo cáo khoa học: "A Hierarchical Bayesian Language Model based on Pitman-Yor Processes" docx

Báo cáo khoa học: "A Hierarchical Bayesian Language Model based on Pitman-Yor Processes" docx

... of natural languages. Bayesian probabilistic mod- els also have additional advantages it is rela- tively straightforward to improve these models by incorporating additional knowledge sources and to ... methods appear as differences among rare words, with the contribution of more common words being neg- ligible. HPYLM performs worse than MKN on words that occurred only once (on average) an...
Ngày tải lên : 17/03/2014, 04:20
  • 8
  • 386
  • 0
Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt

Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt

... plausible way. - The semantic knowledge plays a fundamental role in choosing a particular analysis. Milne argues that a one-word lookahead, with the substantial help of semantic information ... Issue on Natural Lan guage Processing, SlGART Newsletter 79 (1982). Konolige K.G.: A Framework for a Portable Natural Language Interface to Databases. In D.Sagalowicz (ed.): Mechani...
Ngày tải lên : 18/03/2014, 02:20
  • 8
  • 412
  • 0
Báo cáo khoa học: "A Statistical Machine Translation Model Based on a Synthetic Synchronous Grammar" docx

Báo cáo khoa học: "A Statistical Machine Translation Model Based on a Synthetic Synchronous Grammar" docx

... 2. 2.2 The SSG-based Translation Model The translation in our SSG-based translation model can be treated as a SSG derivation. A derivation consists of a sequence of grammar rule applications. To model ... derivations as a latent variable, we define the conditional probability dis- tribution over the target translation e and the cor- Input: A source parse tree T (f J 1 ) Output: A t...
Ngày tải lên : 31/03/2014, 00:20
  • 4
  • 339
  • 1
Báo cáo hóa học: "Fabrication of a Highly Sensitive Chemical Sensor Based on ZnO Nanorod Arrays" doc

Báo cáo hóa học: "Fabrication of a Highly Sensitive Chemical Sensor Based on ZnO Nanorod Arrays" doc

... sensitive chemical sensor based on a ZnO nanorod array that is epitaxially grown on a Pt-coated Si substrate, with a top–top electrode configuration. To practically test the device, its O 2 and NO 2 sensing ... meaning that the interfacial ZnO layer is of an epitaxial quality and that the individual ZnO nanorods are actually defect-free single crystals. To practically test the NRA...
Ngày tải lên : 22/06/2014, 00:20
  • 7
  • 319
  • 0
Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image " pot

Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image " pot

... 10 −5 and reaches a plateau at 100% foraBERof10 −3 before reaching a peak at 200% for a BERof3 × 10 −2 . Clearly additivity is not respected within FlexWave-II and exhibits a large additivity deviation. ... the bitstream un- touched. We can see that the distortion resulting from a bit error at any location in the bitstream is always smaller than the distortion resulting from a tru...
Ngày tải lên : 22/06/2014, 06:20
  • 11
  • 273
  • 0
Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image Satellite Downlink" pptx

Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image Satellite Downlink" pptx

... 10 −5 and reaches a plateau at 100% foraBERof10 −3 before reaching a peak at 200% for a BERof3 × 10 −2 . Clearly additivity is not respected within FlexWave-II and exhibits a large additivity deviation. ... the bitstream un- touched. We can see that the distortion resulting from a bit error at any location in the bitstream is always smaller than the distortion resulting from a tru...
Ngày tải lên : 22/06/2014, 06:20
  • 11
  • 243
  • 0
Báo cáo hóa học: " Research Article Array Iterators in Lustre: From a Language Extension to Its Exploitation in Validation Lionel Morel" doc

Báo cáo hóa học: " Research Article Array Iterators in Lustre: From a Language Extension to Its Exploitation in Validation Lionel Morel" doc

... hardware. Moreover, this approach allows for a straightforward use of standard validation tools associated to the “Lustre without arrays.” 2.1.3. Towards array iterators: some motivations For ... give a contract to that node. An assume-guarantee contract [25]isaformof local specification. It is made of an assertion Boolean clause, that specifies what the component expects from its envir...
Ngày tải lên : 22/06/2014, 22:20
  • 16
  • 296
  • 0

Xem thêm