... With Solid Fuels, a Deadly Risk of Indoor Air Pollution Written by Lawan Davis 29 May 2006 I’m Steve Ember with the VOA Special English Development Report. The World Health Organization says ... report about the dangers of solid fuels. The report says these fuels are the cause of one and one-half million deaths each year. Two out of three deaths happen in Sout...
Ngày tải lên: 14/08/2014, 21:21
... Sensors Capable of Measuring and Evaluating Indoor Air Quality. Indoor Environ., 1, 27–34 (in Japanese). 126 )Kishi, R., Saijo, Y., Kanazawa, A. , Tanaka, M., Yoshimura, T., Chikara, H., Takigawa, T., Morimoto, ... (in Japanese). 113 )Sakai, K., Kamijima, M., Sh ib ata, E., Ohn o, H. and Nakajima, T. (2009) Annual transition and seasonal variation of indoor air pollution leve...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Respiratory health effects of indoor air pollution docx
... acceptation inégale par la collectivité. 1086 The International Journal of Tuberculosis and Lung Disease La contaminación doméstica es relevante para la salud, ya que pasamos la mayor parte ... 74%, and 74% in sub-Saharan Africa, South-East Asia, and the Western Paci c Re- gion, to 36% in the Eastern Mediterranean Region, and 16% in Latin America and the Caribbean and in Central and ....
Ngày tải lên: 17/02/2014, 22:20
Impact of indoor air pollution on health, comfort and productivity of the occupants pot
... quality have been published by ASHRAE, ACGIH, EPA-NIOSH (USA), CSA (Canada), OSHA, Health and Welfare (Canada), BSERA. People have become more aware of environmental pollution, acid rain, ... 121-127 Aerobiologia lat~rattlelal Journal of Aembiolosy Impact of indoor air pollution on health, comfort and productivity of the occupants Jagjit Singh* Associate Director, Osc...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo sinh học: " Codon usage in vertebrates is associated with a low risk of acquiring nonsense mutations" doc
... nonsense mutations may have advantages for organisms with relatively long lifespans and small numbers of offspring. Calculating F is a novel tool for addressing codon usage bias in genes and genomes. ... Flegel * Abstract Background: Codon usage in genomes is biased towards specific subsets of codons. Codon usage bias affects translational speed and accuracy, and it is associated wit...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx
... duodenal solitary Peutz-Jeghers type hamartomatous polyp. Case 1 was a hamartoma- tous polyp with a focus of well-differentiated adenocar- cinoma, and Case 2 was a hamartomatous polyp with Table ... Duodenal hamartoma: apropos of a case report. Radiol Med 1989, 77:134-136. 12. Tanaka H, Iida M, Kohrogi N, Matsui T, Yasunami Y, Yao T, Nakamura K, Fujishma M: Endoscopic removal...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo khoa học: "Drotrecogin alfa (activated): current evidence supports treatment for severe sepsis patients with a high risk of death" ppsx
... 344:699-709. 3. Abraham E, Laterre PF, Garg R, Levy H, Talwar D, Trzaskoma BL, Francois B, Guy JS, Bruckmann M, Rea-Neto A, et al., for the Administration of Drotrecogin alfa (activated) in Early Stage Severe ... PROWESS of 24.97% and 75.03%, respectively. The risk ratios (RR) and odds ratio (OR) are plotted on a natural logarithm scale. n/N equals number of deaths at 28 days/numbe...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo khoa học: "Drotrecogin alfa (activated) in patients with severe sepsis and a high risk of death" ppsx
Ngày tải lên: 13/08/2014, 03:20
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx
... in Developing Asian and Pacific Countries, Policy Uses of Particulate Exposure Estimates, Total Exposure as the Basis of Economic Valuation of Air Pollution in India, Indoor Air Pollution (in Health and Air ... Research Program at the East-West Center. He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa. He has a...
Ngày tải lên: 06/03/2014, 16:20
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx
... the Quikchange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA) with forward primer 5¢-GAAACGATGC ATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverse primer 5¢-GACGCACGGTCGGCATAGGACAAATGCA TCGTTTC-3¢. ... 5¢- CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢- GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ (underlin- ed sequences indicate NdeI and BamHI sites, respectively). The PCR prod...
Ngày tải lên: 22/03/2014, 21:20