Báo cáo y học: "Ribosomal footprints on a transcriptome landscape" potx
... biology. One of the applications of next-generation sequencing - short-read cDNA analysis or ‘RNAseq’ [2,3] - has its conceptual roots in serial analysis of gene expression (SAGE) [4]. Whereas SAGE ... translational control and co-translational processes. RRiibboossoommee pprrooffiilliinngg bbyy RRNNAAsseeqq Following the early demonstration by Steitz of ribosome footprints at the initiatio...
Ngày tải lên: 14/08/2014, 21:20
... 3' 2. SpeA reverse primer, with SpeB overlap: 5' GAGATTTAACAACTGGTTGCTTGGTTGTTAGGTAGAC 3' 3. SpeB forward primer, with SpeA overlap: 5' GTCTACCTAACAACCAAGCAACCAGTTGTTAAATCTC 3' 4. ... the amplified DNA fragment by using the oligonucleotide primer 5' CTCG CAA GAG GTA CAT ATG CAA CAA GAC 3' to produce a unique NdeI site, and 5' GCA GTA GGT AAG CTT GCC A...
Ngày tải lên: 11/08/2014, 10:23
... retropharyn- geal space. Bounded posteriorly by the alar fascia, the ret- ropharyngeal space is limited laterally by the carotid sheaths and parapharyngeal spaces. It extends superiorly to the base ... essential with the ability for active intervention by intubation or a surgical airway. Surgical evacuation of the haematoma is required in only a minor- ity of cases as spontaneous resoluti...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "Genome re-annotation: a wiki solution" potx
... that are well annotated and, beyond that, to start recording the evidence used to annotate each gene. Another solution is to create a new, expanded database that can display all the alternative ... genome annotation deposited in GenBank remains static for years, and many annotations have never been changed since their initial publication. Nonetheless, many scientists assume that GenBank ann...
Ngày tải lên: 14/08/2014, 17:22
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy 1 , Cenk Aypak 2 , Alpay Azap 1 , Önder ... Hospital pharmacy computer data- bases, and 2) International Medication System (IMS). Because Turkey is an inflation country we have esca- lated all antibiotic prices. The cost of antibiotics w...
Ngày tải lên: 25/10/2012, 11:00
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... Fatema Hasan Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, 431003 Correspondence to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, CTS No. 3910, Near Bombay Mercantile ... areas and travels via the motor cortex and pyramidal tract to the ventral brain stem. The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subtha- lamic areas,...
Ngày tải lên: 26/10/2012, 09:57
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... reading frame. The longest transcript (7 kb) harbors five polyadenylation sites (two AATAAA, and three AATTAAA), nine ATTTA sequences [23], two Alu-repeats and three CAGAC motifs [24]. BLAST searches ... and vesicular structures and undergo post-translational phos- phorylation and palmitoylation [40]. Only a small subset of spry1 was recruited to the plasma membrane as part of lipid rafts up...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt
... constituents (Table 1). The approximate molar ratio of Rha to Man was 1 : 1. Abso- lute configuration analysis demonstrated that Man has a D configuration and Rha an L configuration. On methylation analysis, ... residue a and 1–2 Hz for 3 J 1,2 of residue b. The data are summarized in Table 3. Residue a was assigned as a- L -rhamnopyranose (a- L -Rhap). The manno-type configuration was...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo y học: "Expert consensus on hospitalization for assessment: a survey in Japan for a new forensic mental health system" pot
... Psychiatry, Tokyo, Japan. 4 Chiba Psychiatric Medical Center, Chiba, Japan. 5 Mobara Mental Hospital, Chiba, Japan. 6 Chiba Aoba Municipal Hospital, Chiba, Japan. 7 Department of Psychiatry, ... Focus on psychiatry in Japan. Br J Psychiatry 2004, 164:88-92. 4. Nakatani Y, Kojimoto M, Matsubara S, Takayanagi I: New legislation for offenders with mental disorders in Japan. Int J Law Psychiat...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: " Communication patterns in a psychotherapy following traumatic brain injury: A quantitative case study based on symbolic dynamics" pptx
... .019 P: Acknowledging T: Behavioral Analysis/Educational P: Acknowledging IaI .016 T: Behavioral Analysis/Educational P: Acknowledging T: Behavioral Analysis/Educational bfA .016 P: Information (Requesting/Providing) ... T: Psychotherapy as a chaotic process. I. Coding the client-therapist interaction by means of sequential plan analysis and the search for chaos: a stationary approach. Ps...
Ngày tải lên: 11/08/2014, 15:22