Báo cáo y học: " Characterization of taxonomically restricted genes in a phylum-restricted cell type?" pptx

Báo cáo y học: " Characterization of taxonomically restricted genes in a phylum-restricted cell type?" pptx

Báo cáo y học: " Characterization of taxonomically restricted genes in a phylum-restricted cell type?" pptx

... 116 nb035 -sv3 nb035 -sv2 nb035 -sv1 3100 2400 1400 (c) northern-probe nb035-sv2 northern-probe nb035-sv1 (a) GT AG AG AG AG AG AG GT GT GT GT GT nb035-sv3 901 AAAAGATCAGTTCATAAAAGATCTGTTGAAGGAAGGAGATTCATTTACTAA 301 K R S V H K R S V E G R R F I Y nb035-sv2 1570 GAGATTCCATTTGATCCAAGGGAAGCATATGGAAGGAGATTCATTTACTAA 521 E ... Y nb035-sv2 1570 GAGATTCCATTTGATCCAAGGGAAGCATATGGAAGGAGATTCATTTA...

Ngày tải lên: 14/08/2014, 21:20

16 189 0
Báo cáo y học: "Characterization of monocyte/macrophage subsets in the skin and peripheral blood derived from patients with systemic sclerosis" pps

Báo cáo y học: "Characterization of monocyte/macrophage subsets in the skin and peripheral blood derived from patients with systemic sclerosis" pps

... inflammatory infiltrates in early disease stages and accumulation of extracellular matrix proteins resulting in tissue fibrosis. Inflammatory infil- trates are dominated by macrophages and T cells ... analysis, and drafted the manu- script. TM, SF, YI, YK, and HM assisted in the study design and coordination, and oversaw the data analysis and drafting of the manuscript. All authors...

Ngày tải lên: 12/08/2014, 14:22

10 214 0
Báo cáo y học: " Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency" docx

Báo cáo y học: " Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency" docx

... in U1 cells is downregulated by 16 fold Analysis of viral reactivation after treatment of U1 and ACH-2 cells with NaBFigure 1 Analysis of viral reactivation after treatment of U1 and ACH-2 cells ... GGAGTGCG- GTCGCTCTGAAA, IRF8 reverse GTCGTAGGTGGTGTAC- CCCGTCA, Cyclophilin A forward AGTGGTTGGATGGCAAGC, Cyclophilin A reverse GAT- TCTAGGATACTGCGAGCAAA. PCR reactions were car- ri...

Ngày tải lên: 13/08/2014, 09:21

14 316 0
Báo cáo y học: "Characterization of vascular strain during in-vitro angioplasty with high-resolution ultrasound speckle tracking" ppt

Báo cáo y học: "Characterization of vascular strain during in-vitro angioplasty with high-resolution ultrasound speckle tracking" ppt

... longitudinal str ain, shear strain and average data quality index (DQI) would be calculated on the basis of the radial displacement of the lumen wall. The longitudinal strain was calculated as the ... S, Shimada K, Shimada K, Maeda K, Yoshida K, Sunada H, Inanami H, Tanaka H, Jissho S, Taguchi H, Yoshiyama M, Yoshikawa J: Direct Measurement of Wall Stiffness for Carotid Arteries by Ultr...

Ngày tải lên: 13/08/2014, 16:20

11 289 0
Báo cáo y học: "Characterization of heterotypic interaction effects in vitro to deconvolute global gene expression profiles in cancer" ppt

Báo cáo y học: "Characterization of heterotypic interaction effects in vitro to deconvolute global gene expression profiles in cancer" ppt

... paralleled by an increase in STAT1 protein as detected by fluorescence assisted cell sorting (FACS) analysis (Figure B in Additional data file 2). Since breast cancer is a clinically and molecularly heterogene- ous ... co-cultures led to an induction of smooth muscle actin (ACTA2), myosin regu- latory light chain interacting protein (MYLIP), myosin, light polypeptide kinase (MYL), m...

Ngày tải lên: 14/08/2014, 08:20

17 231 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

... quality assurance survey Natalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta Mehta Mount Sinai Hospital, Toronto, Ontario, Canada Correspondence: ... the indication for the CXR, and any resulting changes in management. The ICU team, consisting of the attending physician, a clinical fellow, and a group of housestaff, interp...

Ngày tải lên: 25/10/2012, 10:45

5 507 0
 Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

... 3,4 , Tatsuya Okuno 3 , Naoko Chayahara 3 , Ikuya Miki 3 , Takao Tamura 3 , Tsubasa Inokuma 2 , Yoshiji Takemoto 2 , Tsutomu Nakamura 3 , Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 ... H, Maki H, Takeda Y, et al. Evaluation of combined nedaplatin and docetaxel therapy for human head and neck cancer in vivo. Anticancer Res. 2006; 26: 989-94. 16. Yamashita H, Nakagawa K,...

Ngày tải lên: 26/10/2012, 09:53

7 531 0
Báo cáo y học: "Expression of inflammatory host genes in Chlamydia trachomatis-infected human monocytes" docx

Báo cáo y học: "Expression of inflammatory host genes in Chlamydia trachomatis-infected human monocytes" docx

... infection by Coxiella burnetii or Chlamydia trachomatis. Ann N Y Acad Sci 2003, 990:701-713. 21. O'Connell CM, Ionova IA, Quayle AJ, Visintin A, Ingalls RR: Local- ization of TLR2 and MyD88 ... Th3-like type of response, such as TGF-β, indi- cating that an anti-inflammatory or regulatory, rather than a pro- inflammatory, response is dominating in persistence as opposed to a...

Ngày tải lên: 09/08/2014, 10:20

8 336 0
Báo cáo y học: "Manifestations of Ollier’s disease in a 21-year-old man: a case report" pdf

Báo cáo y học: "Manifestations of Ollier’s disease in a 21-year-old man: a case report" pdf

... considered as the cause of intensely increased uptake. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the ... J Rare Dis 2006, 1:37. Figure 3. Bone scan of the same patient showing areas of radiotracer uptake in the humerus, ulna, femur, tibia, metacarpal, metatarsal and phalyngeal tubular...

Ngày tải lên: 11/08/2014, 14:20

3 265 0
Báo cáo y học: " Validation of rheumatoid arthritis diagnoses in health care utilization data" pptx

Báo cáo y học: " Validation of rheumatoid arthritis diagnoses in health care utilization data" pptx

... antirheumatic drugs included in the study Abatacept Adalimumab Anakinra Azathioprine Cyclosporin D-penicillamine Etanercept Gold Hydroxychloroquine Infliximab Leflunomide Methotrexate Minocycline Rituximab Sulfasalazine Table ... standard definition of RA diag- nosis by a rheumatologist on two separate visits in a study using the Minneapolis Veterans Affairs adminis- trative data [7...

Ngày tải lên: 12/08/2014, 15:22

5 231 0
Từ khóa:
w