Báo cáo y học: " Analysis of the platypus genome suggests a transposon origin for mammalian imprinting" ppt

... Issue 1, Article R1 Research Analysis of the platypus genome suggests a transposon origin for mammalian imprinting Andrew J Pask ¤ *† , Anthony T Papenfuss ¤ ‡ , EleanorIAger * , Kaighin A McColl ‡ , ... compared to the platypus. Conclusions: Our analyses show that the platypus has significantly fewer repeats of certain classes in the regions of the g...

Ngày tải lên: 14/08/2014, 21:20

... normalization of array-CGH data. BMC Bioinformatics 2006, 7:264. 50. Hupe P, Stransky N, Thiery JP, Radvanyi F, Barillot E: Analysis of array CGH data: from signal ratio to gain and loss of DNA regions. ... insight into the spread of cancerous cells to different parts of the organ, or di fferent parts of the body. Analysis of the copy number profiles of metastases...

Ngày tải lên: 09/08/2014, 20:22

... binding affinity for Dlg. Upper panel. The cartoon shows the last 11 amino acid residues of Avian (A) and Human (H) NS1, together with the non-PDZ-binding mutant of Avian NS1 (Aa), plus the avian ... suggest that data obtained from single domain assays should be treated with caution. We had previously shown by crystallographic and mutational analysis that the specificities...

Ngày tải lên: 11/08/2014, 21:21

... TGA GGA ACT WCT GTC TTC ACG CRG 10.2 Negative 310 293 CAC TCG CAA GCA CCC TAT CAG 9. 1a- flap Positive 24 42 AAT AAA TCA TAA GAC ACT CCA CCA TRG ATC ACT C 9. 2a- flap Negative 344 323 AAT AAA TCA ... 7:155 http://www.virologyj.com/content/7/1/155 Page 3 of 11 Analysis of the sequence variability Our previous analyses of the sequence variability of the 5'UTR of HCV-1 fou...

Ngày tải lên: 12/08/2014, 04:20

... aaaggctagtcaagtgaagcagtgg hY4 4) ggctggtccgagtgcagtg aaagccagtcaaatttagcagtggg hY5 4) agttggtccgagtgttgtggg aaaacatgcaagctagtcaagcgcg U1 5) cctggcaggggagataccatgatcacg ggggaaagcgcgaacgcagtccccc U2 5) cttcttggccttttagctaagatc ggtgcactgttcctggaggtactgc U4 5) gctttgcgcagtggcagtatcg ... cccgggaggtcaccatatt Vif gatggcaggtgatgattgtgtgg ctgtccattcattgtatggc hY1 4) ggctggtccgaaggtagtga aaagactagtcaag...

Ngày tải lên: 13/08/2014, 05:22

... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgat- gctctaccgactgagctatccgggc 3' (tRNA Lys,3 ); 2. 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg ... aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and 5' tgccccgtgtgaggatcgaactcacg accttcagattatgagact- gacgcgctacctactgcgctaacgagg 3 (tRNA Met(e) ); 3. 5' aat...

Ngày tải lên: 13/08/2014, 09:20

... 5'-CCTCCTTGGACTTGGACCTT-3', 5'- AGGACAGGAGTCTTGCCAAA-3'; CB555845: 5'-GTCAACAGGCTGGCATTTTA-3', 5'-CAAT- TATTGACCCCAAGGCTA-3'; CX078592: 5'-CAAAGCCATCAGACAGCAGA-3', ... 5'-GAGAC- CAGGAAAGTCGAAGG-3'; CB552531: 5'-CTGGAATAAGGCCAGAAGCA-3', 5'-ATTCCT- CAGGTCTGGTGGAG-3'; CX078596: 5'-CCTCATGGTGTGGCTATGTG-3', 5...

Ngày tải lên: 14/08/2014, 14:21

... BP, FCD and FC analyzed and interpreted the data. All authors read and approved the final manuscript. Acknowledgements The authors are grateful to the RA family members for their participation; ... between the HLA-DRB1 gene and RA, and linkage data for that gene. In the present study we tested this classification for validity in an independent sample. A new sample of th...

Ngày tải lên: 09/08/2014, 08:22

... independent and dependent pathways; they recruit and stimulate T cells and monocytes by the production of chemokines, especially IL-6 and SDF-1 (CXCL12) and they can attract and retain B lymphocytes by ... through the vascular endothelium at distant locations, and the establishment of new tumors. Each of these steps has been analyzed by gene-expression microarrays in both experime...

Ngày tải lên: 09/08/2014, 08:22

... described the onset of brachial plexus palsy after a few days after a dis- placed clavicle fracture. Other possibilities for the appear- ance of the symptoms and especially for the delayed onset could ... a family physician and thus knows the available options, he asked for an intramedullary nail and the surgeon agreed. Post-surgi- cally, the pain disappeared ini...

Ngày tải lên: 10/08/2014, 10:20