Báo cáo y học: "Life is a Ponzi scheme" potx
Báo cáo y học: "Life is a Ponzi scheme" potx
... immigrants to Canada. The bank eventually failed because of bad real-estate loans - sounds familiar? - but Ponzi stayed on in Canada where eventually he was jailed for three years for check forgery. ... wasn't buying and selling postal reply coupons. In fact, he wasn't arbitraging anything. What he was actually doing was running what is called a pyramid scheme: as long as mone...
Ngày tải lên: 14/08/2014, 21:20
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients. Anesth Analg 2005, 101:1470-1476. 28. ... <0.001 Data are expressed as median (interquartile range) or as mean ± standard deviation. *P values are from the chi-squared test, one-way analysis of variance, or...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic identification and bio- logical validation of neuroendocrine ... 2004, was obtained from all subjects. ELISA assays hVgf ELISA, microtiter plates were coated with 2-mg/mL goat polyclonal anti-Vgf antibody (R15) (Santa Cruz Biotech, Santa Cruz,...
Ngày tải lên: 03/11/2012, 10:52
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC (b) t WGFTLKG...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf
... 1 Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer Wigard P Kloosterman, 1 Marlous Hoogstraat, 1,2 Oscar Paling, 2 Masoumeh Tavakoli-Yaraki, 1 ... primary tumor, metastasis and normal liver and colon samples. Rearrangement fusion points were visualized by Circos software [38]. SNP-array analysis DNA from all 16...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf
... (Nef 71-81 ) d55 KPQVPLRPMTY d169 RPQVPLRPMTY d253 RPQVPLRPMTY d415 RPQVPLRPMTY HLA -A2 YTAFTIPSI (RT 127-135 ) YTAFTIPSI YTAFTIPSI/T YTAFTIPST YTAFTIPST MM27 HLA -A2 YTAFTIPSI (RT 127-135 ) d28 YTAFTIPSV d53 YTAFTIPSV d81 YTAFTIPSV d299 YTAFTIPSV/I d466 YTAFTIPSI MM28 ... per- formed as previously described [3]. Briefly, HIV-1 RNA was isolated from plasma using a QIAamp viral RNA mini kit...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7 Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8 Laboratory of Disease ... Immunodeficiency Virus Type 1 Replication. J Virol 2004, 78:6073-6076. 15. Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H:...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "What is a virulence factor" pot
... bacterial virulence factor by itself to initiate disease. Finally, the importance of the O antigen and capsular polysaccharides as virulence determinants can be demon- strated by the fact that ... antibodies directed against the O antigens of Gram-negative bacteria are highly protective [7,8] and that many of the licensed vaccines against bacterial pathogens are directed against the capsular...
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... defined as respiratory distress, and normal mental status without pulmonary infiltrates or arterial hypoxemia. The study excluded children with an exacer- bation of reactive airways disease. If patients ... of asthma was lack- ing, the history gleaned from the medical records sup- ported an asthma diagnosis. Most patients with asthma are not cared for by asthma specialists and frequently the...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf
... 28-day and 6-month survival on a univariate analysis. After a multivariate analysis, severe sepsis determined the highest hazard ratio (HR) for 28-day (adjusted HR, 3.13; 95% CI, 1.21-8.07) and ... comparing pre- and post- HAART eras, with emphasis on causes of admission and risk factors for mortality [2-7]. A large cohort of HIV critically ill patients showed that sepsis is among the...
Ngày tải lên: 13/08/2014, 21:21