Báo cáo y học: "Life is a Ponzi scheme" potx
Báo cáo y học: "Life is a Ponzi scheme" potx
... immigrants to Canada. The bank eventually failedbecause of bad real-estate loans - sounds familiar? - but Ponzi stayed on in Canada where eventually he was jailed forthree years for check forgery. ... wasn'tbuying and selling postal reply coupons. In fact, he wasn'tarbitraging anything. What he was actually doing wasrunning what is called a pyramid scheme: as long as moneykept ... statecharges, Charles Ponzi was deported to Italy in 1934. Hedied a pauper in a charity hospital in Rio de Janeiro on 18January 1949. It now appears that Bernard Madoff was running a similarpyramid...
- 4
- 197
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197.27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali-dation of a behavioral pain scale in critically ill, sedated, andmechanically ventilated patients. Anesth Analg 2005,101:1470-1476.28. ... <0.001Data are expressed as median (interquartile range) or as mean ± standard deviation. *P values are from the chi-squared test, one-way analysis of variance, or the Kruskal-Wallis test to compare ... the analyzer Cobas Integra (RocheDiagnostics, Mannheim, Germany). The limits of detectionwere 0.071 mg/dl.Statistical analysesData are presented as the mean ± standard deviation for vari-ables...
- 10
- 597
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic identification and bio-logical validation of neuroendocrine ... 2004, was obtained from all subjects. ELISA assays hVgf ELISA, microtiter plates were coated with 2-mg/mL goat polyclonal anti-Vgf antibody (R15) (Santa Cruz Biotech, Santa Cruz, CA), which ... Biotech, CA). The assay was developed using a stabilized HRP substrate. All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard. Assessment...
- 8
- 499
- 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC (b) t WGFTLKGGLEH GEPLIISKVEEGGKADTLSSKLQAGDEVV 77 HSLSPISHAFTRESGARHIPSALPLAPEGGCCGGEVPALSGTHQTRPELA ... Miyagawa-Tomita S, Yanazawa M, Katoh-Fukui Y, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S, Yokoyama M: Mouse Pitx2 deficiency leads to anomalies of the ventral body wall, heart,...
- 36
- 446
- 0
Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf
... 1Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer Wigard P Kloosterman,1 Marlous Hoogstraat,1,2 Oscar Paling,2 Masoumeh Tavakoli-Yaraki,1 ... primary tumor, metastasis and normal liver and colon samples. Rearrangement fusion points were visualized by Circos software [38]. SNP-array analysis DNA from all 16 tumor and control samples ... Shimada K, Kosuge T, Okusaka T, Kato K, Kusuda J, Yoshida T, Aburatani H, Shibata T: High-resolution characterization of a hepatocellular carcinoma genome. Nature genetics 2011. 17. Myllykangas...
- 29
- 405
- 0
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf
... (Nef71-81)d55KPQVPLRPMTYd169RPQVPLRPMTYd253RPQVPLRPMTYd415RPQVPLRPMTYHLA -A2 YTAFTIPSI (RT127-135) YTAFTIPSI YTAFTIPSI/T YTAFTIPST YTAFTIPSTMM27 HLA -A2 YTAFTIPSI (RT127-135)d28YTAFTIPSVd53YTAFTIPSVd81YTAFTIPSVd299YTAFTIPSV/Id466YTAFTIPSIMM28 ... per-formed as previously described [3]. Briefly, HIV-1 RNAwas isolated from plasma using a QIAamp viral RNAmini kit (QIAGEN), and cDNA was synthesized fromreplicate plasma virus RNA preparations ... titrations of either index o r variant sequencepeptide(s) in IFNg ELISPOT assays. A variant peptidewas deemed an escape variant if its half-maximal stimu-latory concentration was at least...
- 13
- 370
- 0
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8Laboratory of Disease ... Immunodeficiency Virus Type 1 Replication. J Virol2004, 78:6073-6076.15. Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T,Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H: Ubiquitina-tion ... Hirofumi Akari8, Yoshio Koyanagi9, Jun Fujita3 and Takashi Uchiyama1Address: 1Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku,...
- 12
- 692
- 0
Báo cáo y học: "What is a virulence factor" pot
... bacterial virulence factor by itself to initiate disease.Finally, the importance of the O antigen and capsularpolysaccharides as virulence determinants can be demon-strated by the fact that ... antibodies directed against the Oantigens of Gram-negative bacteria are highly protective [7,8]and that many of the licensed vaccines against bacterialpathogens are directed against the capsular ... Seguin M, Yuan L, Kelly N, Hammack C, SadoffJ, Gemski P Jr.: The importance of a lipopolysaccharide-initi-ated, cytokine-mediated host defense mechanism in miceagainst extraintestinally invasive...
- 2
- 332
- 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... defined as respiratory distress, and normalmental status without pulmonary infiltrates or arterialhypoxemia. The study excluded children with an exacer-bation of reactive airways disease. If patients ... of asthma was lack-ing, the history gleaned from the medical records sup-ported an asthma diagnosis. Most patients with asthmaare not cared for by asthma specialists and frequently thediagnosis ... hypothesisthat appropriately aggressive treatment of asthma in chil-dren with sickle cell disease may diminish the frequencyof pulmonary complications.Patients with reactive airway disease...
- 5
- 288
- 0
Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf
... 28-day and6-month survival on a univariate analysis. After a multivariate analysis, severe sepsis determined the highest hazardratio (HR) for 28-day (adjusted HR, 3.13; 95% CI, 1.21-8.07) and ... comparing pre- and post-HAART eras, with emphasis on causes of admission andrisk factors for mortality [2-7]. A large cohort of HIVcritically ill patients showed that sepsis is among thecauses ... Emergency Physicians; Canadian Critical Care Society;European Society of Clinical Microbiology and Infectious Diseases, et al:Surviving Sepsis Campaign: international guidelines for management...
- 8
- 409
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ