Báo cáo y học: "Prioritizing functional modules mediating genetic perturbations and their phenotypic effects: a global strategy" potx

... the functional modules that mediate genetic perturbations and their phenotypic effects among can-didate modules. </p> Abstract We have developed a global strategy based on the Bayesian network ... network framework to prioritize the functional modules mediating genetic perturbations and their phenotypic effects among a set of overlapping candidate m...

Ngày tải lên: 14/08/2014, 21:20

... things' had loading equal to 0.25 on hyperactivity/inattention scale and a secondary loading was added on prosocial behav- iour scale (with a loading of -0.23). The modification indices also ... Hadjipanayi Y, Pandeli P: European Early Promo- tion Project Primary Health Care Worker Training Manual. Belgrade: Institute of Mental Health; 2000. 3. Achenbach TM: Diagnosis, assessment...

Ngày tải lên: 08/08/2014, 23:21

... RNA was extracted with TRIzol in accordance with the manual. Microarray data analysis The MG_U74Av2 oligonucleotide chip (array A; Affymetrix, Santa Clara, CA, USA), representing all functionally ... ag-3' 5'-cag aat tgc cat tgc aca ac-3' 134 IL-17 5'-cct aag aaa ccc cca cgt tt-3' 5'-ttc ttt tca ttg tgg agg gc-3' 129 TNF-α 5'-acg gca tgg atc tca aag ac...

Ngày tải lên: 09/08/2014, 06:22

... GGCGATGCTGGCGCTGAGTAC TGGTTCACACCCATGACGA [GenBank:NM_000095 ] MMP1 TACATGCGCACAAATCCCTTCTACC GAAAAACCGGACTTCATCTCTGTCG [GenBank:NM_002421 ] MMP13 CAAAAACGCCAGACAAATGTGACC GATGCAGGCGCCAGAAGAATCT [GenBank:NM_002427 ] SOX9 ... number COL 1A1 CGATGGCTGCACGAGTCACAC CAGGTTGGGATGGAGGGAGTTTAC [GenBank:NM_000088] COL1 0A1 GAACTCCCAGCACGCAGAATCC GTGTTGGGTAGTGGGCCTTTTATG [GenBank:NM_000493 ] COL 2A1 CC...

Ngày tải lên: 09/08/2014, 14:22

... L, Allantaz F, Mejias A, Ardura M, Kaizer E, Monnet L, Allman W, Randall H, Johnson D, Lanier A, Punaro M, Wittkowski KM, White P, Fay J, Klintmalm G, Ramilo O, Palucka AK, Banchereau J, Pascual ... anti-Ro (SS -A) and, secondarily, with anti-single-stranded DNA, lupus nephritis was inversely associated with anti-La (SS-B) and associated with anti-dsDNA. It has been repeatedly shown that...

Ngày tải lên: 09/08/2014, 14:22

... Fujikura J, Hosoda K, Kawaguchi Y, Noguchi M, Iwakura H, Odori S, Mori E, Tomita T, Hirata M, Ebihara K, Masuzaki H, Fukuda A, Furuyama K, Tanigaki K, Yabe D, Nakao K: Rbp-j regulates expansion ... M, Nakamura S, Mori K, Kawauchi T, Terao M, Nishimura YV, Fukuda A, Fuse T, Matsuo N, Sone M, Watanabe M, Bito H, Terashima T, Wright CV, Kawaguchi Y, Nakao K, Nabeshima Y: Ptf 1a, a bHLH tr...

Ngày tải lên: 10/08/2014, 05:21

... Bonno* 1 , Makoto Obata 1 , Hatsumi Yamamoto 1 , Masatoshi Kawai 2 and Yoshihiro Komada 3 Address: 1 Clinical Research Institute and Department of Pediatrics, National Hospital Organization, Miechuo ... of gestation age and 14.4% had birth weight of less than 1000 g. The median age at hospitalization was 0 day (range: 0–9 day) and the median duration of hospi- talization was 32 day...

Ngày tải lên: 10/08/2014, 09:20

... contrast materials. Case Report: A 77 years old man presenting with acute renal failure and haemoglobin decrease arrived with an expanding pseudoaneurysm of the left axillary artery from a pacemaker ... surgical approach in the axillary area may be associated with many complications, such as major blood loss and potential damage of adjacent neurovascular structures. The surgical inacc...

Ngày tải lên: 10/08/2014, 09:21

... showed that Diabetes is significantly associated with lower baseline INVOS Table 1 Demographic data and data on risk factors for coronary and/ or peripheral vascular disease in cardiac and vascular ... conduct any power analysis for sample size estimation , and there was no randomization or blinding. Data were prospec- tively collected and securely stored in an electronic database. A...

Ngày tải lên: 10/08/2014, 09:22

... "Sapienza", Latina, Italy References 1. Morita S, Yasui H, Harasawa Y, Tomita Y, Tominaga R: Extensive use of artificial Chordae for repairing diffuse mitral valve prolapse. Ann Thorac ... mitral leaflets and subvalvular apparatus and placed two 3-0 e-PTFE mattress sutures: one placed and tied at the tip of the anterior papillary muscle, and one at the tip of the posteri...

Ngày tải lên: 10/08/2014, 10:20