Báo cáo y học: " Cell death upon epigenetic genome methylation: a novel function of methyl-specific deoxyribonucleases" docx
Báo cáo y học: " Cell death upon epigenetic genome methylation: a novel function of methyl-specific deoxyribonucleases" docx
... (5'- GGGggtaccGTGAACAAAAGAGATATACAACTAC-3') and StoMcrBC-rev (5'-GGGgtcgacTTAGATTTTACGATTTTCGCC TTTT-3'), or StoMcrBC2-for (5'-GGGggtaccGTGAGGTTAA- GAAAAAGAGATCTAG-3') and StoMcrBC2-rev ... (5'-GGGgtcgacTTAAACCTCTCCCGAAGAGCAGA GG-3'), TkoMcrBC2-for (5'-GGGggtaccATGAATCAATCAGT- TATAATAGATG-3') and TkoMcrBC2-rev (5'-GGGgtcgac- CTAGTTTATTAGC...
Ngày tải lên: 14/08/2014, 21:20
Báo cáo y học: "Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system" ppsx
... from the larval pan-neural (LP), embryonic pan-neural (EP), larval A- class (LA), and embryonic A- class (EA) micro- array datasets. Additional data file 2 is a master annotation file of all spots ... A- class (LA), and embryonic A- class (EA) microarray datasetsEnriched genes from the larval pan-neural (LP), embryonic pan-neural (EP), larval A- class (LA), and embryonic A- class (E...
Ngày tải lên: 14/08/2014, 07:22
Báo cáo y học: " Altered retinal microRNA expression profile in a mouse model of retinitis pigmentosa" docx
... miRanda. The miRNA array data are available at Array Express [58] using accession numbers E-TABM-329 and E-TABM-332. Additional data file 1Retinal miR expression data from Exiqon microarray analysisLog 2 ... [57]. Normalized log 2 -transformed Hy3/Hy5 ratios were used for further analysis. Data availability Microarray data from the above studies are available at the public database Array Expr...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Cell death serum biomarkers are early predictors for survival in severe septic patients with hepatic dysfunction" pptx
... The key mediators of apoptosis are caspases, leading to the caspase-dependent pathway of apoptotic cell death. Cas- pases are intracellular cysteine proteases that cleave various substrates including ... intermediate filament protein) as a marker of cell death, isolated CK-18 fragments as a marker of apoptosis, as well as IL-6, soluble vascular cell adhesion molecule, and...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: "Cell death in sepsis: a matter of how, when, and where" potx
... effector cells and, alternatively, the capacity of apoptotic cells to induce anergy and a shift to a Th 2 -cell response. Furthermore, apoptosis of gastrointestinal epithelial cells may compromise the ... A, Yao J, Degterev A, Xavier RJ, Yuan J: Identification of a molecular signaling network that regulates a cellular necrotic cell death pathway. Cell 2008, 135:1311-13...
Ngày tải lên: 13/08/2014, 18:22
Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf
... and 5¢-AAGCTTCCTTCATGATGCG CTTGG-3¢; PPARc,5¢-TGGAATTAGATGACAGCGAC TTGG-3¢ and 5¢-CTGGAGCAGCTTGGCAAACA-3¢;glyc- eraldehyde-3-phosphate dehydrogenase (GAPDH), 5¢-AAC ATCATCCCTGCCTCTAC-3¢ and 5¢-CTGCTTCACCACC TTCTTG-3¢; ... confluence. After 14 days of induction, the majority of the cells displayed a phe- notype of mature adipocytes (Fig. 4A) . The neutral lipids accumulated in the cytop...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
... Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tom- ida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances ... constructs (a) (b) 0 0.5 1 1.5 2 2.5 3 APBB2 -A APBB2-B APBB2-C APP -A APP-B APP-C APP-D BCL2L11 -A BCL2L11-B BCL2L11-C BCL2L11-D BCL2L11-E CCND1 -A CCND1-B CCND1-C CCND1-D CCND2 -...
Ngày tải lên: 14/08/2014, 20:22
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot
... and fetal pancreas and in pancreatic tumoral cell lines [35,36]. FAPP and BSSL are structurally closely related, but are distinguished by a monoclonal antibody directed towards a fucosylated epitope, ... fresh human milk samples as previously described [31]. RNA hybridization was per- formed essentially as described in Sambrook et al.[32]. Approximately 20 lg of each RNA preparation w...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "Exogenous glucosamine globally protects chondrocytes from the arthritogenic effects of IL-1β" docx
... GTAACTCCAATGCCACCACA Collagen alpha 1 type II Forward, GTGGAGCAGCAAGAGCAAGGA Reverse, CTTGCCCCACTTACCAGTGTG CXCL5 (LIX) Forward, CACCCTGCTGGCATTTCTG Reverse, AACCATGGCCGAGAAAGGA MMP-3 Forward, CTGGAATGGTCTTGGCTCAT Reverse, ... (Invitro- gen-Molecular Probes, Carlsbad, CA, USA), was washed, and was visualized with a microarray scanner (Genearray Scanner; Agilent Technologies, Santa Clara, CA...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation" pptx
... K, Arakawa T, Nakamura M, Kubosaki A, Hayashida K, Kawazu C, Murata M, Nishiyori H, Fukuda S, Kawai J, Daub CO, Hume DA, Suzuki H, Orlando V, Carninci P, Hayashizaki Y, Mattick JS: Tiny RNAs associated ... of attenuator regulation in each gene family through a systematic literature survey and comparison to the Rfam RNA family database [38] and to the RegulonDB database of E. coli tran...
Ngày tải lên: 09/08/2014, 22:23