Báo cáo y học: "Assignment of isochores for all completely sequenced vertebrate genomes using a consensus" pot

... 78.6 Percentage of the human genome classified into the same isochore families by each pair of methods. The amount of equally classified human DNA ranges from 59-86% in an all- against -all pairwise comparison. ... 3Analysis of isochore families in all genomes and analysis of differ-ences between methodsAnalysis of isochore families in all genomes and analysis of diff...

Ngày tải lên: 14/08/2014, 20:22

... that melittin also displays antivi- ral activity. Analogous to antibacterial activity, the antiviral activity of melittin has been attributed to direct lysis of viral membranes, as demonstrated ... anti-retroviral therapy (ART). This may cause a decrease in viral load and improvement in clinical as well as immunological status. Insect venom and human Phospholipase A 2 (PLA 2 ) have p...

Ngày tải lên: 10/08/2014, 05:21

... markers for each 3 cM yielding a total of 36 markers; 7 cM: markers for each 7 cM yielding a total of 16 markers; 15 cM: markers for each 15 cM yielding a total of 8 markers. Three types of markers ... an equal allele frequency. The average 574 A. C. Sørensen et al. interval mapping and accuracy of prediction in MAS) was closely related to E A (Fig. 4a) . This justifie...

Ngày tải lên: 14/08/2014, 13:21

... on a MegaBACE 1000 (Amersham Pharmacia Biotech). Activity and inhibition assays The enzymatic activity and inhibition rates of the FVIIa variants were measured as described [9] using an assay buffer ... FVIIa variants. All values are means ± SD (n ¼ 3). The amidolytic activity is given as the ratio between the activity of mutant and wild-type FVIIa. FVIIa variant Amidolytic activity...

Ngày tải lên: 08/03/2014, 09:20

... entered using EpiData (version 3.02) package; 10% of the records were randomly checked to assess the quality of data entry. The final data were ana- lyzed using the statistical software package SPSS ... immu- nization. Enrolment and data collection A field office was established at Qayoomabad and the counselors visited each house in Qayoomabad and adja- cent sectors of Manzoor col...

Ngày tải lên: 11/08/2014, 16:22

... '-omics' and reviews the most important biological sequence databases, such as the host databases, immunological databases, patho- gen databases, and T cell and B cell databases. Chapter ... study of vaccines has captured the attention of the biomedical and public communities for the past hundred years, largely because vaccines play a key role in affecting lifespan and well...

Ngày tải lên: 12/08/2014, 04:21

... leading to respiratory, pancreatic, and gastro- intestinal disorders [1]. Forty years ago, CF was invariably a fatal disease of early childhood. Although the disease remains incurable, advances in CF ... selection of lung transplant candidates: The American Society for Transplant Physicians (ASTP)/ American Thoracic Society(ATS)/European Respiratory Society(ERS)/International Society...

Ngày tải lên: 12/08/2014, 16:20

... criteria. Blood samples were taken on the first and second day of hospitalization, and on the day of discharge or on the day of death. For multiple group comparisons one-way analysis of variance was ... potassium and calcium, aspartate aminotransferase, alanine aminotransferase, prothrombin time, activated partial thromboplastin time, albumin, transferrin and CRP); and arterial bloo...

Ngày tải lên: 12/08/2014, 19:21

... multifaceted study of human papillomavirus and prostate carcinoma. Cancer 1998, 82:1118-1125. 27. Wang XG, Revskaya E, Bryan RA, Strickler HD, Burk RD, Casadevall A, Dadachova E: Treating cancer as an infectious ... polymor- phism G138 5A (rs486907) responsible for the R462Q mutation. PCR was carried out with R462Q_F CCTAT- TAAGATGTTTTGTGGTTGCAG, R462Q _A GGAAGATGT- GGAAAATGAGGAAG and...

Ngày tải lên: 12/08/2014, 23:22

... ligands, and other properties, RAW264.7 has been chosen by the Alliance for Cellular Signaling as the primary experimental system for their large-scale study of signaling pathways [5]. The RAW264.7 cell ... 1 Laboratory of Immunopathology, NIAID, NIH, Bethesda, MD 20892, USA, 2 Laboratory of Persistent Viral Diseases, Rocky Mountain Laboratories, NIAID, NIH, Hamilton, MT 59840, U...

Ngày tải lên: 13/08/2014, 06:20