Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc
... subspecies: Trypanosoma brucei gambiense and Trypanosoma brucei rhodesiense, which are the cause of sleeping sickness in humans; and the nonhuman infective Trypanosoma brucei brucei subspecies. Over the ... analyzed the data, and wrote the manuscript. AC, LS, ATw, and LM car- ried out the experimental work. All authors read and approved the final manusc...
Ngày tải lên: 14/08/2014, 20:22
Báo cáo y học: "Genetic analysis of HIV-1 Circulating Recombinant Form 02_AG, B and C subtype-specific envelope sequences from Northern India and their predicted co-receptor usage" pot
... 80:750-758. 13. Dash PK, Sidappa NB, Mangaiarkarasi A, Mahendarkar AV, Roshan P, Anand KK, Mahadevan A, Satishchandra P, Shankar SK, Prasad VR, Ranga U: Exceptional molecular and coreceptor-requirement properties ... Vishnampettai G Ramachandran 2 , Vijesh K Sreedhar 3 , Ajay Wanchu 3 , Nilanjana Ghosh 1 and Akhil C Banerjea* 1 Address: 1 Virology Laboratory, National Institute of...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Genetic analysis of chikungunya viruses imported to mainland China in 2008" pps
... design and coordination of the study. LD provided reagents and participated in the design and coordination of the study, as well as in the analysis of the data and drafting and editing of the manuscript. ... fever, arthralgia, myalgia, headache, and rash [2]. The virus is transmitted mainly from human to human by the bite of the Aedes mosquito, pr...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "Texture analysis of cartilage T2 maps: individuals with risk factors for OA have higher and more heterogeneous knee cartilage MR T2 compared to normal controls - data from the osteoarthritis initiative" pptx
... 44-47], and varying spatial patterns of T 2 values in osteoarthritic cartilage [48]. Therefore, quantifying only mean values of cartilage T 2 may mask important information regarding the spatial ... Gabby B Joseph 1,# , Thomas Baum 1 , Julio Carballido-Gamio 1 , Lorenzo Nardo 1 , Warapat Virayavanich 1 , Hamza Alizai 1 , John A Lynch 2 , Charles E McCulloch 2 , Sharmila Maj...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Systematic analysis of transcribed loci in ENCODE regions using RACE sequencing reveals extensive transcription in the human genome" pptx
... long: 5'-CTAATACGACTCACTATAGGGCAAGCAGT- GGTATCAACGCAGAGT-3'; UPM short: 5'-CTAATACGACT- CACTATAGGGC-3'). Complementarity between NGSPs and NUP (nested universal primer A) , particularly ... was hybridized in triplicate to both the forward- strand and reverse-strand version of the array, using the manufacturer's standard hybridization, staining, and wash...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"
... publication bias (Li- near regression analysis, ref.[34] All analysis was done by using the Statistical Analysis System software (v.9.1.3, SAS Institute, Cary, NC) and Review Manage (v.4.2). All the ... than 95% of esophageal malignancies [48]. In our meta -analysis, we had wanted to analysis the associa- tion between these two gene polymorphisms and risk of esophage...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx
... present the nucleotide sequence, as well as a systematic structural and functional analysis of the 5¢ flanking region of the Bsep gene. The 5¢ deletional analysis of the Bsep promoter revealed a region ... bases in bold) and sense (5¢-GCTAGAGCTGGACTTTATTCCATT GAAATA-TAAGCAAACAGTG-3¢) oligonucleotide of the IR-1 element was used in a temperature cycling reactio...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: Structural analysis of the lipopolysaccharide from nontypeable Haemophilus influenzae strain 1003 potx
... Biological Sciences, National Research Council of Canada, Ottawa, Ontario, Canada Structural analysis of the lipopolysaccharide (LPS) of nontypeable Haemophilus influenzae strain 1003 has been achieved ... were recovered on a S epPak C18 cartr idge. The relative proportions of the various alditol acetates and partially methylated alditol acetates obtained in sugar and met...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo y học: "Expression analysis of three isoforms of hyaluronan synthase and hyaluronidase in the synovium of knees in osteoarthritis and rheumatoid arthritis by quantitative real-time reverse transcriptase polymerase chain reaction" potx
... probe a AGATGTCCAGATTTTA 96 – 111 HAS-3 888F TGTCCAGATCCTCAACAAGTACGA 888 – 911 1005R AATACACTGCACACAGCCAAAGTAG 1005 – 981 probe TCATGGATTTCCTTCCTGAGCAGCGT 913 – 938 HYAL-1 1561F AGTGGTGCTCTGGGTGAGCT ... Ymagata S, Iyoda K, Ito H, Hasegawa Y, Iwata H: Examination of synovial fluid and serum hyaluroni- dase activity as a joint marker in rheumatoid arthritis and oste- oarthritis pat...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "Detailed analysis of the variability of peptidylarginine deiminase type 4 in German patients with rheumatoid arthritis: a case– control study" docx
... GRB, and AS partici- pated in the coordination of the study and in drafting the man- uscript. TD participated in the design and coordination of the study, and critically revised the manuscript. All ... Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.: Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are ass...
Ngày tải lên: 09/08/2014, 07:20