Báo cáo sinh học: "Marginal inferences about variance components in a mixed linear model using Gibbs sampling" ppsx

Báo cáo sinh học: "Marginal inferences about variance components in a mixed linear model using Gibbs sampling" ppsx

Báo cáo sinh học: "Marginal inferences about variance components in a mixed linear model using Gibbs sampling" ppsx

... at least one of the variance components is close to O. Original article Marginal inferences about variance components in a mixed linear model using Gibbs sampling CS Wang* JJ ... from a Bayesian viewpoint, Gianola and Foulley (1990) derived a new method for estimation of variance components in a mixed linear model: variance...
Ngày tải lên : 14/08/2014, 20:20
  • 22
  • 249
  • 0
Báo cáo sinh học: " Research Article Minimum Variance Signal Selection for Aorta Radius Estimation Using Radar" pptx

Báo cáo sinh học: " Research Article Minimum Variance Signal Selection for Aorta Radius Estimation Using Radar" pptx

... problem. Instead, we have opted for an analytical approach based on a mathematical representation of the channel and on the derivation of the CRLB. In order to obtain a mathematically tractable model, a ... We further elaborated a channel model dependent on three parameters: a cylinder of radius r of lossy material is immersed in a lossy material separated from the antenna...
Ngày tải lên : 21/06/2014, 16:20
  • 13
  • 329
  • 0
Báo cáo sinh học: "Bayesian inference about dispersion parameters of univariate mixed models with maternal effects: theoretical considerations" doc

Báo cáo sinh học: "Bayesian inference about dispersion parameters of univariate mixed models with maternal effects: theoretical considerations" doc

... Bayesian model for inference about variance and covariance components in a mixed linear model describing a trait affected by maternal effects. The formulation is general in the ... about 10, a trial value for 1, and retaining the linear terms leads to: Original article Bayesian inference about dispersion parameters of univariate mi...
Ngày tải lên : 14/08/2014, 20:20
  • 29
  • 269
  • 0
Báo cáo sinh học: " Research Article Multiplicative Noise Removal via a Novel Variational Model" doc

Báo cáo sinh học: " Research Article Multiplicative Noise Removal via a Novel Variational Model" doc

... the total variation seminorm as regularizer. A variational model involving curvelet coefficients for cleaning multiplicative Gamma noise was considered in [23]. As information carriers, all images are ... by taking loga- rithms and proposed Bayesian type variational model. Steidl and Teuber [22] introduced a variational restoration model consisting of the I-divergence as data fitting...
Ngày tải lên : 21/06/2014, 16:20
  • 16
  • 225
  • 0
Báo cáo sinh học: " Contrast enhancement of stimulus intermittency in a primary olfactory network and its behavioral significance" pdf

Báo cáo sinh học: " Contrast enhancement of stimulus intermittency in a primary olfactory network and its behavioral significance" pdf

... curl 0 20 40 60 80 100 120 W ing fan ning Upw ind flight C lose hover S ource con tact A bdomen curl Unoperated Saline injection Bicuculline (a) (b) (c) Percentage Percentage Percentage aaa a a a a a b a a b a a b aaa a b a a aa a aa aaa aaa aa a a a a a aa (e) Pheromone Solvent ... digitized flight-track analyses (flight speed, acceleration, heading angles) were ana...
Ngày tải lên : 06/08/2014, 18:21
  • 15
  • 365
  • 0
Báo cáo sinh học: "Bayesian estimation of dispersion parameters with a reduced animal model including polygenic and QTL effects" pot

Báo cáo sinh học: "Bayesian estimation of dispersion parameters with a reduced animal model including polygenic and QTL effects" pot

... J.J., Gianola D., Marginal inferences about variance compo- nents in a mixed linear model using Gibbs sampling, Genet, Sel. Evol. 25 (1993) 41-62. [32] Wang C.S., Quaas R.L., ... chain Monte Carlo algorithms are increasingly used to draw statistical inferences about marginal posterior distributions of parameters in genetic models. The...
Ngày tải lên : 09/08/2014, 18:22
  • 23
  • 295
  • 0
Báo cáo sinh học: "Prion gene (PRNP) haplotype variation in United States goat breeds (Open Access publication)" ppsx

Báo cáo sinh học: "Prion gene (PRNP) haplotype variation in United States goat breeds (Open Access publication)" ppsx

... produced using primers (CAGAGCTTCTAGGGTCCTCAC and GACAGCAATAAA- GAAATGCACA, corresponding to positions 21 857–21 877 and 24 334– 24 355, respectively, in GenBank Accession No. U67922) and TOPO-TA Cloning Kit ... 713–721. [6] Capucchio M.T., Guarda F., Pozzato N., Coppolino S., Caracappa S., Di Marco V., Clinical signs and diagnosis of scrapie in Italy: a comparative study in sheep a...
Ngày tải lên : 14/08/2014, 13:21
  • 9
  • 418
  • 0
Báo cáo sinh học: "Accuracy of direct genomic values in Holstein bulls and cows using subsets of SNP markers" docx

Báo cáo sinh học: "Accuracy of direct genomic values in Holstein bulls and cows using subsets of SNP markers" docx

... relationships calculated from pedigree are shown between training and validation animals (ALL) and between training animals and validation animals whose sires were included (Sire) or were not included ... animals. If animals in the training and evaluation data share DNA segments from a small number of ancestors, relatively few markers are required to trace the segments shared between rela...
Ngày tải lên : 14/08/2014, 13:21
  • 15
  • 232
  • 0
Báo cáo sinh học: "Data transformation for rank reduction in multi-trait MACE model for international bull comparison" doc

Báo cáo sinh học: "Data transformation for rank reduction in multi-trait MACE model for international bull comparison" doc

... correlation rather than covariance matrices, especially if traits with greatly differing varia- tion are included. In a covariance matrix, functions of traits with high variances have high eigenvalues and are ... between models for national and international evaluations have become increasingly evident. In order to optimise genetic evaluation models for both national and international ev...
Ngày tải lên : 14/08/2014, 13:22
  • 14
  • 218
  • 0
báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx

báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx

... and absorbance immediately read at 450 nm. Oxidized pro- tein standards, internal controls and blanks were always assayed at the same time and in the same way. All samples were always determined ... known amount of the internal standard is added to each sample, after solid phase extraction samples are derivatized and purified by thin layer chromatography, and finally analyzed. An aliquot .....
Ngày tải lên : 19/06/2014, 22:20
  • 9
  • 490
  • 0