Báo cáo sinh học: "Second chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern" potx

... w4 h1d" alt="" Note Second chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern C ... giving support to the assumption of random mating. This result is in agreement with those obtained by Ruiz et al (1991) in a Spanish natural...

Ngày tải lên: 14/08/2014, 20:20

... evolutionary history of Drosophila buzzatii. XIII. Random differentiation as a partial explanation of the observed chromosomal variation in a structured natural population. Am Nat ... Double mating and sperm predominance A Barbadilla JE Quezada-Díaz, A Ruiz M Santos, A Fontdevila Universidad Autdnoma de Barcelona, De P artamento de Genetica...

Ngày tải lên: 14/08/2014, 20:20

... the conception and design, acquisition of data, and interpretation of data, was involved in drafting the manuscript, and revising it critically for important intellectual content. All authors have read and ... of data; was involved in drafting the manuscript and revising it critically for important intellectual content. NM contributed to the acquisition of data and int...

Ngày tải lên: 13/08/2014, 14:20

... models, assisted in data collection, analyzed the data, and drafted the manuscript. CP and EM assisted with data analysis and drafting of the manuscript. All authors read and approved the final manuscript. Competing ... resources and the operations of each training institution had not been cent rally maintained at the MoH, and the granular level of detail required for...

Ngày tải lên: 18/06/2014, 17:20

... P. Nakmahachalasint, “Hyers-Ulam-Rassias and Ulam-Gavruta-Rassias stabilities of an additive functional equation in several variables,” International Journal of Mathematics and Mathematical Sciences, vol. ... Moslehian, and S. Zolfaghari, “Stability of a mixed type additive, quadratic, cubic and quartic functional equation,” in Nonlinear Analysis and Variational Problems...

Ngày tải lên: 21/06/2014, 16:20

... (5'-CCT GCG GCT TAA TTT GAC TC-3' and 5'-GAC AAA TCG CTC CAC CAA CT-3'), and 25S rDNA gene (5'-CGC GAG TTC TAT CGG GTA AA-3' and 5'-CAC TTG GAG CTC TCG ATT CC-3'). ... TT-3' and 5'-GTA CAA AGG GCA GGG ACG TA-3'), and 25S rDNA gene (5'- AGA ACC CAC AAA GGG TGT TG-3' and 5'-TCC CTT GCC TAC ATT GTT CC-3'). The...

Ngày tải lên: 12/08/2014, 05:20

... espe- cially for moderately and highly heritable traits. The herds of this breed were located primarily within the same region: the Pyrenean area of Ca talonia (Spain). Because almost all of the matings ... herds. Discussion TheBLUPofbreedingvaluesallowscomparisons between animals if the reliability is high enough, but the individual reliability is not a sufficient measure of...

Ngày tải lên: 14/08/2014, 13:21

... replicates of Gibbs chains of 100 000 cycles were run for each anal- ysis, using a spacing of 50 cycles, obtaining 2000 Gibbs samples per chain and 40 000 samples in total for each analysis. A burn -in ... marker information is unavailable. With segregation analysis, it is possible to determine, using only phenotypic data, whether the inheritance of a certain trait i...

Ngày tải lên: 14/08/2014, 13:22

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC T3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAG...

Ngày tải lên: 16/03/2014, 16:20

... dependent variables with subsequent years of data [18] and discussion of clin- ical plausibility of health demand by a panel of specialists [44] are also means of keeping in line with an evolving reality. Lastly, ... specialty, because incidence of the diseases managed within that care specialty can be approximated with more accuracy. An example is the radiologists f...

Ngày tải lên: 18/06/2014, 17:20