Báo cáo sinh học: "Second chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern" potx
Báo cáo sinh học: "Second chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern" potx
... w4 h1d" alt="" NoteSecond chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating patternC ... giving support to the assumption of random mating. Thisresult is in agreement with those obtained by Ruiz et al (1991) in a Spanish natural population of D buzzatii. However, ... our analysis is based on the assumption that the offspring of each wildinseminated female was fathered by a single male. Concerning this, female remat-ing has often...
- 16
- 198
- 0
Báo cáo sinh học: "The evolutionary history of Drosophila buzzatii. XVII. Double mating and sperm" pot
... evolutionary history of Drosophila buzzatii. XIII. Random differentiation as a partial explanation of the observedchromosomal variation in a structured natural population. Am Nat ... Double mating and spermpredominance A BarbadillaJE Quezada-Díaz, A RuizM Santos, A FontdevilaUniversidad Autdnoma de Barcelona, DePartamento de Genetica y Microbiologia,08193 ... clearthat a single insemination is not sufficient to fertilize all the eggs a female cannormally lay. This is against one assumption of the model of Prout and Bungaard(1977),...
- 8
- 227
- 0
Báo cáo y học: "Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis" pot
... theconception and design, acquisition of data, and interpretation of data, wasinvolved in drafting the manuscript, and revising it critically for importantintellectual content. All authors have read and ... of data; was involved in drafting the manuscript and revisingit critically for important intellectual content. NM contributed to theacquisition of data and interpretation of data and was involved ... theimportance of human rights considerations in the con-text of natural disasters and the humanitarian response:5. Human rights are the legal underpinning of allhumanitarian work pertaining to natural...
- 14
- 338
- 0
báo cáo sinh học:" Doubling the number of health graduates in Zambia: estimating feasibility and costs" pdf
... models, assisted in data collection, analyzed the data, and drafted the manuscript. CP and EM assisted with data analysis and drafting of the manuscript. All authors read and approved the final manuscript.Competing ... resources and the operations of each training institution had not beencent rally maintained at the MoH, and the granular level of detail required for planning a national expansion of training institutions ... training quality standards mandateTable 4 Total one-time costs that are necessary to achieve the 94% scale-up of public training institutions and meetquality training standards, ZambiaOne-off...
- 9
- 609
- 0
Báo cáo sinh học: " Research Article Stabilities of Cubic Mappings in Fuzzy Normed Spaces" pptx
... P. Nakmahachalasint, “Hyers-Ulam-Rassias and Ulam-Gavruta-Rassias stabilities of an additivefunctional equation in several variables,” International Journal of Mathematics and Mathematical Sciences,vol. ... Moslehian, and S. Zolfaghari, “Stability of a mixed typeadditive, quadratic, cubic and quartic functional equation,” in Nonlinear Analysis and VariationalProblems, P. M. Pardalos, T. M. Rassias, and ... Zolfaghari, J. M. Rassias, and M. B. Savadkouhi, “Solution and stability of a mixedtype cubic and quartic functional equation in quasi-Banach spaces,” Abstract and Applied Analysis, vol.2009, Article...
- 15
- 294
- 0
báo cáo khoa học: " Large-scale polymorphism of heterochromatic repeats in the DNA of Arabidopsis thaliana" ppt
... (5'-CCTGCG GCT TAA TTT GAC TC-3' and 5'-GAC AAA TCG CTCCAC CAA CT-3'), and 25S rDNA gene (5'-CGC GAG TTCTAT CGG GTA AA-3' and 5'-CAC TTG GAG CTC TCG ATTCC-3'). ... TT-3' and 5'-GTACAA AGG GCA GGG ACG TA-3'), and 25S rDNA gene (5'-AGA ACC CAC AAA GGG TGT TG-3' and 5'-TCC CTTGCC TAC ATT GTT CC-3').The amount of heterochromatic ... and carried out the qPCR, filter array, flowcytometry and CGH assays and analyses, and drafted themanuscript. AT carried out the FISH assays and partici-pated in their interpretation and analysis....
- 15
- 260
- 0
Báo cáo sinh học: "Connectedness among herds of beef cattle bred under natural service" pot
... espe-cially for moderately and highly heritable traits. Theherds of this breed were located primarily within thesame region: the Pyrenean area of Ca talonia (Spain).Because almost all of the matings ... herds.DiscussionTheBLUPofbreedingvaluesallowscomparisonsbetween animals if the reliability is high enough, but theindividual reliability is not a sufficient measure of risk in comparing animals across he rds, and ... artificialinsemination and of an active exchange program, con-nectedness was expected to be more limited in theBruna dels Pirineus breed than in the Bazad ais breed and, especially, the Charolais...
- 9
- 149
- 0
Báo cáo sinh học: "Bayesian segregation analysis of milk flow in Swiss dairy cattle using Gibbs sampling" pdf
... replicates of Gibbs chains of 100 000 cycles were run for each anal-ysis, using a spacing of 50 cycles, obtaining 2000 Gibbs samples per chain and 40 000 samples in total for each analysis. A burn -in ... marker information is unavailable. With segregation analysis,it is possible to determine, using only phenotypic data, whether the inheritance of a certain trait is controlled, at least in part, ... flow, and to investigate whether a segregating major gene a ecting milkflow exists in three breeds of Swiss dairy cattle, using 4 to 22 years of milkflow data. A Bayesian segregation analysis using...
- 14
- 232
- 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAGHC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCCT3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGACMG3X ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGACXHO-TNF13 ... Yoshiyuki Kayano, Sayaka Nakao, Nagisa Sakurai,Hiroyuki Iwata1 and Rumi IshisakaDepartment of Biological Chemistry and 1Department of Veterinary Medicine, Faculty of Agriculture, Yamaguchi University,Yamaguchi,...
- 12
- 512
- 0
báo cáo sinh học:" Physician supply forecast: better than peering in a crystal ball?" doc
... dependent variables with subsequent years of data [18] and discussion of clin-ical plausibility of health demand by a panel of specialists[44] are also means of keeping in line with an evolvingreality.Lastly, ... specialty,because incidence of the diseases managed within thatcare specialty can be approximated with more accuracy.An example is the radiologists forecast in Australia. Oneradiation oncologist is ... an optimum standard of service and to keep the population healthy. This planning method combinesinformation on the health status of the population with disease prevalence, demographics and appropriate...
- 13
- 545
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ