Báo cáo sinh học: "Antiviral drugs against hepatitis C virus" pot

... AD, Boguszewska-Chachulska AM: New acridone-4-carboxylic acid derivatives as potential inhibitors of hepatitis C virus infection. Bioorg Med Chem 2008, 16:8846-8852. 57. Chen CS, Chiou CT, Chen GS, Chen SC, ... innovative compound, ACH-806 (GS 9132) is characterized as antiviral agent against HCV by using HCV replicon system. ACH-806 was discovered by using HCV replicon cells [35]. Mech...

Ngày tải lên: 14/08/2014, 19:22

... acg cag HCV 10.2 positive cac tcg caa cca ccc tat cag HCV 1 negative act gtc ttc acg cag aag cgt cta gcc at HCV 2 negative cga gac ctc ccg ggg cac tcg caa gca ccc HCV 3 negative acg cag aaa gcg ... HCV Primer Strand Sequence (5' to 3') 1 HCV 9.1 positive gac act cca cca tag atc act c HCV 9.2 positive cat gat gca cgc tct acg aga c HCV 10.1 positive ctg tga gga act act gtc ttc acg...

Ngày tải lên: 19/06/2014, 08:20

... Forward: ACCACAGTCCATGCCATCAC: and GAPDH reverse; TCCACCACCCTGTTGCTGTA PCR was performed by initial denaturation at 95 C for 5 min followed by 30 cycles, each of denaturation at 92 C for 45s, ... calculate the c oncentra- tion HCV RNA of each sample. Cy3STD/Res Fam. STD / Res × coefficient IC = IU HCV/m L IC = internal control, which is specific for each lot. Antiviral activity of GL agai...

Ngày tải lên: 18/06/2014, 22:20

... epidemio- logical characteristics will require further analysis. In con- clusion, unsafe injections among drug addicts as well as medical practices occur routinely in Pakistan, implying a significant potential ... drug addicts, of which 2 million are chronic heroin addicts. Since the early 1980s, political and economic changes within the region have facilitated a dramatic increase of poverty...

Ngày tải lên: 18/06/2014, 18:20

... different replicon systems. A selection of different bicistronic and monocistronic replicon constructs including subgenomic and full-length HCV sequences is depicted schematically. Stably replicating ... Rice CM. Efficient initiation of HCV RNA replication in cell culture. Science 2000; 290: 1972-4. 10. Bartosch B, Dubuisson J and Cosset FL. Infectious hepatitis C virus pseudo-particl...

Ngày tải lên: 02/11/2012, 10:00

... transplant recipients [2]. Besides accelerated deterioration of liver function in chronic HCV infection, HCV-related glomerulopathy [3] and HCV-associated fibrosing cholestatic hepatitis [4] ... renal transplant recipient with dual infection with hepatitis B and C viruses: a case report Ming-Ling Chang 1 , Ping-Chin Lai 2 and Chau-Ting Yeh 3* Abstract Introduction: Accelerated liver fun...

Ngày tải lên: 10/08/2014, 23:21

... Zein N: Clinical significance of hepatitis C virus genotypes. Clin Microbiol Rev 2000, 13:223-235. 20. Henquell C, Cartau C, Abergel A, et al: High prevalence of hepatitis C virus type 5 in central ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and G...

Ngày tải lên: 12/08/2014, 02:20

... 7:334 http://www.virologyj.com/content/7/1/334 © 2010 Ali et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), ... J, Herion D, Gerlach T, Pape G, Lau J, Hoofnagle J, Blum H, Jake T: Antibodies Against Hepatitis C Virus- Like Particles and Viral Clearance i...

Ngày tải lên: 12/08/2014, 02:20

... amplification and detection were accomplished concurrently with TaqMan technology (Applied Biosystems, Foster City, Calif) using fluorescent probes to detect amplification after each replicating cycle. ... SmartCycler II Real-time PCR (Cepheid, Sunnyvale, Calif. USA) utilizing HCV RN A quantifica- tion kits (Sacace Biotechnologies, Italy). The SmartCy- cler II system is a PCR system by which...

Ngày tải lên: 12/08/2014, 04:20