Báo cáo sinh học: "Antiviral drugs against hepatitis C virus" pot

Báo cáo sinh học: "Antiviral drugs against hepatitis C virus" pot

Báo cáo sinh học: "Antiviral drugs against hepatitis C virus" pot

... AD, Boguszewska-Chachulska AM: New acridone-4-carboxylic acid derivatives as potential inhibitors of hepatitis C virus infection. Bioorg Med Chem 2008, 16:8846-8852. 57. Chen CS, Chiou CT, Chen GS, Chen SC, ... innovative compound, ACH-806 (GS 9132) is characterized as antiviral agent against HCV by using HCV replicon system. ACH-806 was discovered by using HCV replicon cells [35]. Mech...

Ngày tải lên: 14/08/2014, 19:22

10 261 0
Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot

Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot

... acg cag HCV 10.2 positive cac tcg caa cca ccc tat cag HCV 1 negative act gtc ttc acg cag aag cgt cta gcc at HCV 2 negative cga gac ctc ccg ggg cac tcg caa gca ccc HCV 3 negative acg cag aaa gcg ... HCV Primer Strand Sequence (5' to 3') 1 HCV 9.1 positive gac act cca cca tag atc act c HCV 9.2 positive cat gat gca cgc tct acg aga c HCV 10.1 positive ctg tga gga act act gtc ttc acg...

Ngày tải lên: 19/06/2014, 08:20

17 479 0
Báo cáo sinh học: "Glycyrrhizin as antiviral agent against Hepatitis C Virus" potx

Báo cáo sinh học: "Glycyrrhizin as antiviral agent against Hepatitis C Virus" potx

... Forward: ACCACAGTCCATGCCATCAC: and GAPDH reverse; TCCACCACCCTGTTGCTGTA PCR was performed by initial denaturation at 95 C for 5 min followed by 30 cycles, each of denaturation at 92 C for 45s, ... calculate the c oncentra- tion HCV RNA of each sample. Cy3STD/Res Fam. STD / Res × coefficient IC = IU HCV/m L IC = internal control, which is specific for each lot. Antiviral activity of GL agai...

Ngày tải lên: 18/06/2014, 22:20

7 609 0
Báo cáo sinh học: " Common Genotypes of Hepatitis B virus prevalent in Injecting drug abusers (addicts) of North West Frontier Province of Pakistan" doc

Báo cáo sinh học: " Common Genotypes of Hepatitis B virus prevalent in Injecting drug abusers (addicts) of North West Frontier Province of Pakistan" doc

... epidemio- logical characteristics will require further analysis. In con- clusion, unsafe injections among drug addicts as well as medical practices occur routinely in Pakistan, implying a significant potential ... drug addicts, of which 2 million are chronic heroin addicts. Since the early 1980s, political and economic changes within the region have facilitated a dramatic increase of poverty...

Ngày tải lên: 18/06/2014, 18:20

6 484 0
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

... different replicon systems. A selection of different bicistronic and monocistronic replicon constructs including subgenomic and full-length HCV sequences is depicted schematically. Stably replicating ... Rice CM. Efficient initiation of HCV RNA replication in cell culture. Science 2000; 290: 1972-4. 10. Bartosch B, Dubuisson J and Cosset FL. Infectious hepatitis C virus pseudo-particl...

Ngày tải lên: 02/11/2012, 10:00

6 497 1
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

... transplant recipients [2]. Besides accelerated deterioration of liver function in chronic HCV infection, HCV-related glomerulopathy [3] and HCV-associated fibrosing cholestatic hepatitis [4] ... renal transplant recipient with dual infection with hepatitis B and C viruses: a case report Ming-Ling Chang 1 , Ping-Chin Lai 2 and Chau-Ting Yeh 3* Abstract Introduction: Accelerated liver fun...

Ngày tải lên: 10/08/2014, 23:21

4 283 0
Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

... Zein N: Clinical significance of hepatitis C virus genotypes. Clin Microbiol Rev 2000, 13:223-235. 20. Henquell C, Cartau C, Abergel A, et al: High prevalence of hepatitis C virus type 5 in central ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and G...

Ngày tải lên: 12/08/2014, 02:20

7 257 0
Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

... 7:334 http://www.virologyj.com/content/7/1/334 © 2010 Ali et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), ... J, Herion D, Gerlach T, Pape G, Lau J, Hoofnagle J, Blum H, Jake T: Antibodies Against Hepatitis C Virus- Like Particles and Viral Clearance i...

Ngày tải lên: 12/08/2014, 02:20

5 268 0
Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

... amplification and detection were accomplished concurrently with TaqMan technology (Applied Biosystems, Foster City, Calif) using fluorescent probes to detect amplification after each replicating cycle. ... SmartCycler II Real-time PCR (Cepheid, Sunnyvale, Calif. USA) utilizing HCV RN A quantifica- tion kits (Sacace Biotechnologies, Italy). The SmartCy- cler II system is a PCR system by which...

Ngày tải lên: 12/08/2014, 04:20

7 368 0
w