Báo cáo sinh học: "B cells Can Modulate the CD8 Memory T Cell after DNA Vaccination Against Experimental Tuberculosis" potx
... mediated by central memory CD8 T cells [10]. Despite the differences between these approaches and DNA vaccination they demonstrated the importance of B cells in inducing memory CD8 T cells. In the ... anti-sense TTG GAA TGC AGA CAC CAC CT; T- bet sense CCC CTG TCC AGT CAG TAA CTT; T- bet anti-sense CTT CTC TGT TTG GCT GGC T; Foxp3 sense ACA ACC TGA GCC TGC ACA...
Ngày tải lên: 14/08/2014, 19:22
... 5%, the absolute growth rates of the parental strain and most of the mutant strains are reduced by the stress. This is reflected in Figure 3a,b by the position of the mutants’ points below the ... environmental stresses, consistent with the perception that stress diminishes the organism’s ability to tolerate deleterious mutations. Here, we ask whether there are also stresses...
Ngày tải lên: 06/08/2014, 18:20
... lymphocyte activation whose expression is not limited to the lymphoid system. The fact that these genes’ expression is not limited to the lymphoid system does not diminish the potential role they ... show the phenotypes after expressing the cDNA inserts (followed by IRES-GFP) in a naïve Jurkat-tTA population. After retroviral infection, the Jurkat-tTA (4D9#32) cells were e...
Ngày tải lên: 06/08/2014, 18:20
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... 1830 (1723) GGGTACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAAATGAACATTTTTTGTTGCCAGGTAGGTGCTGACACGTTG canus fam EcoRI BamHI (1681) GGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACACGTTG pK9 ... Xenopus TATTGTACCTGGAGATATATGCTGACACGC Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCC...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "stem cells, influenza, pit bulls, Darwin, and more" ppsx
... evolutionary issues – in one case, the longstanding issue of the path to our remote ancestry; in the other, the more recent question of how exactly the evolution of form and function refl ects the ... ve, though it might affect the last two or three on the list. Indeed, the two most accessed articles, an Opinion from Arthur Lander on the stem cell concept [1] and a Q...
Ngày tải lên: 06/08/2014, 19:21
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... rituximab treatment start to repopu- late the B -cell compartment about 6 months after the treatment ends. The kinetics appears to be similar in patients with autoimmune diseases. On the positive ... in reconsidering the role of the B cell in these diseases [3,4]. A new therapeutic strategy – targeting CD20 + B cells All pilot studies of B -cell- depleting treatments have...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx
... cit- rate. The pores at the top of the scaffold were created by the salt leaching and those at the bottom were made by the sol- vent evaporation. Therefore, the scaffold had micropores on the top ... from the histological findings. In the biochemical findings, the chondroitin sulfate content increased over the time course of the implant, whereas the hydroxyproline...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "B cells in Sjögren’s syndrome: indications for disturbed selection and differentiation in ectopic lymphoid tissue" doc
... SLE. Thus, the disturbances of the B -cell subsets seem to be unique for each of the respective diseases [68]. It is of potential interest that the status of the peripheral B -cell subset distribution ... ectopic ‘tertiary’ and/or secondary lymphoid tissues. It is noteworthy that the combined results of recent studies indicate that detectable GC-like structures within these ecto...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "B cells in autoimmunity" ppsx
... able to activate dendritic cells to be more effective antigen-presenting cells and, with the help of T cells, to enhance the differentiation of memory B cells into plasma cells in the presence ... not an essential survival factor of these pre-naïve cells compared with naïve B cells. Finally, these cells had the capacity to differentiate into plasma cells after s...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "B cells from rheumatoid arthritis patients show important alterations in the expression of CD86 and FcgRIIb, which are modulated by anti-tumor necrosis factor therapy" potx
... anti-MCV titers after 6 mont hs of therapy . Others have repor ted that changes in these antibodies become significant after 18 months of anti-TNF therapy [53], so it is conceivable that a full ... 5c). Anti-tumor necrosis factor therapy can influence B -cell phenotype in rheumatoid arthritis patients Next, we wanted to evaluate whether the alterations observed on RA patients’ B cel...
Ngày tải lên: 12/08/2014, 12:20