Báo cáo sinh học: " Hepatitis C virus genotype 3a with phylo

Báo cáo sinh học: " Hepatitis C virus genotype 3a with phylogenetically distinct origin is circulating in Pakistan" ppt

... phylogenetic analysis. Conclusion: The nucleotide difference of these seven sequences shows that HCV genotype 3a of phylogenetically distinct origin is circulating in Pakistan. Findings Hepatitis C virus ... Access Hepatitis C virus genotype 3a with phylogenetically distinct origin is circulating in Pakistan Irshad-ur Rehman, Muhammad Idrees * , M...

Ngày tải lên : 14/08/2014, 19:22

3
219
0

Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot

... populations are chronically infected with HCV, most of these cases occur in Africa, which is reported to have the highest HCV prevalence rate [2,3]. Although, direct percutaneous inoculation is the most ... Anti-HCV. Authors' contributions RME and AAD carried out the clinical study and partici- pated in the statistical analysis and procedures, MAE par- ticipated in the analys...

Ngày tải lên : 18/06/2014, 18:20

3
399
0

Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

... forms of steatosis present in patients with hepatitis C, specifically metabolic steatosis and HCV-induced steatosis. Metabolic steatosis is a process which occurs in the setting of obesity, ... distinct forms of steatosis in patients with chronic hepatitis C. Metabolic steatosis generally occurs in all genotypes of HCV infections and likely worsens the progression...

Ngày tải lên : 02/11/2012, 09:51

4
438
0

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

... and genotypes 4, 5 and 6 (C) . Int. J. Med. Sci. 2006, 3 37 Chronic hepatitis C In patients with clinical or biological signs of chronic liver disease, chronic hepatitis C is certain ... exacerbation of chronic hepatitis C or an acute hepatitis of another cause in a patient with chronic hepatitis C. Acute hepatitis C is very unlikely if both anti-HC...

Ngày tải lên : 02/11/2012, 09:56

6
612
0

Báo cáo sinh học: " Hepatitis B virus (HBV) genotypes in Egyptian pediatric cancer patients with acute and chronic active HBV infection" pptx

... from India have provided conflicting results in this context. In a study of chronic carriers in which, surprisingly, 50% of the patients were infected with genotype A strains and 50% were infected ... of hepatitis viruses and geno- typic distribution of hepatitis B and C viruses in Harbin, China. Jpn J Infect Dis 2003, 56:19-22. 32. Chen B, Kao FJH, Liu CJ, Chen DS, Chen PJ:...

Ngày tải lên : 18/06/2014, 18:20

7
415
0

Báo cáo sinh học: " Hepatitis C (HCV), hepatitis B (HBV), the human immunodeficiency viruses (HIV), and other viruses that replicate via RNA intermediaries," pdf

... deficient and non- infections, indicating intact genotype- specific HCV enve- lope sequences are essential for proper HCV replication. Specific replacement of p7 of the 1a clone with p7 from an infectious ... including viruses, that lack innate adaptability, for whom replication is contingent upon a chance confluence of appropri- ate cellular conditions – including permissive cell rece...

Ngày tải lên : 18/06/2014, 22:20

14
329
0

Báo cáo sinh học: " Hepatitis B virus X protein interacts with β5 subunit of heterotrimeric guanine nucleotide binding protei" pptx

... Abstract Background: To isolate cellular proteins interacting with hepatitis B virus X protein (HBX), from HepG2 cells infected with hepatitis B virus (HBV). Results: HBV particles were produced in culture medium ... nucleotide binding protein Siew Hui Lwa and Wei Ning Chen* Address: School of Chemical and Biomedical Engineering and School of Biological Sciences, College of Eng...

Ngày tải lên : 19/06/2014, 08:20

8
374
0

Báo cáo sinh học: " Hepatitis B Virus: Inactive carriers" ppt

... alcohol. The clinical spectrum of HBV infection ranges from subclinical to acute sympto- matic hepatitis or, rarely, fulminant hepatitis during the acute phase and from the inactive hepatitis ... expected to progress to cirrhosis and end-stage liver disease [1]. Difficulties in defining the nat- ural history of chronic hepatitis B include the indolent course of the disease, the lack...

Ngày tải lên : 19/06/2014, 08:20

5
367
0

Báo cáo hóa học: " Hepatitis C virus NS5A protein binds the SH3 domain of the Fyn tyrosine kinase with high affinity: mutagenic analysis of residues within the SH3 domain that ?" doc

... binding to SH3 domains. In this context it will be of great interest to determine which SH3 domain containing proteins interact with NS5A in cells infected with HCV, such experiments are ongoing ... the hepatitis C virus non- structural protein 5A. J Biol Chem 2002, 277:8130-8139. 4. Tellinghuisen TL, Marcotrigiano J, Gorbalenya AE, Rice CM: The NS5A protein of hepatitis C...

Ngày tải lên : 20/06/2014, 01:20

9
447
0

Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx

... 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT- TCCAGAACCCG-3' (initiation codon underlined). Preparation of other HCV protein expression constructs have ... pcDNA3.1(+)-FLAG- tagged expression vector [43]. Primers for NS3/4A; 5'- AAGGGGGGATCCACCATG GCGCCCATCACGGCG- TACGCCCAGCAG-3', 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATC...

Ngày tải lên : 20/06/2014, 01:20

13
475
1