... Kirkpatrick DL: Training and Performance Appraisal - Are they Related? Improving Employee Performance Through Appraisal and Coaching 2006. 65. Kuvaas B: Performance Appraisal Satisfaction and ... 1 An exploration of the effects of performance appraisal in municipal health services. How goal setting, feedback and active participation in performance appraisal together with the trainin...
Ngày tải lên: 18/06/2014, 17:20
... combination forms were studied, including (1) intramuscular administration of non- coating DNA vaccine, (2) gene gun administration of DNA vaccine coated on gold particles, and (3) gene gun administration ... survival was tested by Kaplan-Meier analysis. DNA vaccination by needle intramuscular injection For intramuscular needle-mediated DNA vaccination, 100 μg /mouse of Sec-...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: "Anti-tumor effects of a human VEGFR-2-based DNA vaccine in mouse models" pps
... therapy, and plasmid DNA vaccines[7]. Plasmid DNA vaccines are attractive because they are relatively easy to engineer and produce, and are safe to administer to humans [8-10]. A number of studies ... delivered by an attenuated strain of Salmonella typhimu- rium[29]. Plasmid DNA vaccines are attractive because they are relatively easy to engineer and produce, and are safe to admin...
Ngày tải lên: 14/08/2014, 19:22
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ⁄ W168F ⁄ Y74W TCA CCGGTCCATGATCCATT ... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G,...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... NRG-5¢_for NRG -a_ rev TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG 668 b NRG-5¢_for NRG-Beta_rev TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC 677 GAPDH GAPDH_for GAPDH_rev GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT 450 Fig. ... protein expression in U373 cells and mouse brain was analyzed using the antibody against the C-terminus or against the extracellular domain. Cell lysate or the m...
Ngày tải lên: 16/03/2014, 04:20
báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt
... technical advances, changes in the public and private health systems, an increasing number of professionals, increasing female enrollment in health professions, and changes in educational guidelines are ... an exploratory data analysis technique to reveal natural grouping from latent patterns in a large data set on the basis of a minimal within-group and a maximal between-gr...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Therapeutic effects of pyrrolidine dithiocarbamate on acute lung injury in rabbits" ppt
... and advising data analysis as well as writing manuscript JH: making study plan and advising data analysis as well as writing manuscript All authors read and approved the final manuscript Acknowledgements The ... in paraffin wax, stained with hematoxylin and eosin, and examined under a light microscope. The lung injury was scored according to inflammatory changes, hemorrhage of alveoli a...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
... still result in a mean value indicating average risk of CVD (2.2 mg/L) [33]. The mechanism behind such action remains unclear. It has been postulated that a reduction in CRP is attained via the positive ... that the aim of the training programme was not to directly target weight loss for a reduction of cardiovascular risk, but instead to improve physiological capacity, and bio...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo sinh học: "The effects of lipids on channel function" pdf
... lipid headgroup and the two fatty acyl chains occupy roughly equal areas in the plane of the lipid bilayer, has a cylindrical shape, and so packs well into a bilayer (Figure 1b). However, a lipid ... lipid such as PA or phos- pha tidylethanolamine (PE), for which the area of the headgroup is small relative to that of the two chains, has a conical shape and will prefer to p...
Ngày tải lên: 06/08/2014, 19:21
Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx
... the values of Qh and A as shown in the Appendix. The average amount of preferential treatment actually applied was assessed via a simula- tion of 1000 replicates of the ... the appropriate assumptions of preferential treatment. A Bayesian analysis of the data set according to each of the three models was carried out in each rep...
Ngày tải lên: 09/08/2014, 18:21