Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... the same cell substrate using the ultracentrifugation and the PB/DT protocols. Again, in spite of a three-fold increment of the vector RNA titer after supernatant ultracentrifugation, transduction ... maturation, thus show- ing that they were still functional. A further observation of interest was that LAW34 transduction of DCs and T cells occurred also in the absence o...
Ngày tải lên: 14/08/2014, 19:22
... contact with the sub- strate. This suggests that a suitable contact at position 266 is required to hold the substrate in the catalytic cleft. In addition, the Ald-hydrolytic activity of the Asp266 ... demonstrating that the mutant efficiently con- verts the unnatural amide compounds even at low substrate concentrations, and potentially possesses an advantage for biotechnological applic...
Ngày tải lên: 07/03/2014, 00:20
... and the DAGs, as explicated below. PATR-II grammars consist of rules with a context-free phrase structure portion and a set of unifications on the DAGs associated with the constituents that ... cat values of the DAGs associated with the filial constituents; the left side, the eat of the parent The associated uni- fications specify equivalences that must exist among the...
Ngày tải lên: 24/03/2014, 01:21
báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt
... plausibility. Cluster analysis was used as an exploratory data analysis technique to reveal natural grouping from latent patterns in a large data set on the basis of a minimal within-group and ... services, owing to the high demand and the growing need of high complexity treatments. Private dental care is affected by cost and supplier factors. Treatment fees have great impact on...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: "Rational design of HIV vaccines and microbicides: report of the EUROPRISE network annual conference 2010" potx
... approach of this assay with a fast, objective automatic readout platform. The assay was implemented with an image analysis tool, which allows storage of the data and analysis of further parameters ... challenge. Additional data indicated that maturation of the maca- que response against the virus was of key im portance in conferring protection, and that this maturation conti...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx
... an animal surviving to a particular age, Lx); survival rate (probability at a particular age of surviving to the next age, Px); mortality rate (probability at a particular ... management and breeding plan The data used for the study were from the University of Alberta ranch at Kinsella, located 150 km south-east of Edmonton, Alberta,...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf
... efficient implementation. One important task yet to be completed is to add these innovative techniques into the Statistics for Patterns package (SPatt) the purpose of which is to gather and make available ... increase with the pattern complexity which could thus result again in untractable computations. Another tempting option is to ignore the particular structure of the data set by a...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo sinh học: " Identification of a differentially expressed gene, ACL, between Meishan · Large White and Large White · " pps
... 57 ACL GSP1 CAGCCAAGGGTGGTCCTGC Smart3 0 CAGAGTACTTTTTTTTTTTTTTTT 57 ACL GSP2 AGCAGGGGCTGTATCGTC R1 NGTCGASWGANAWGAA R2 GTNCGASWCANAWGTT R3 WGTGNAGWANCANAGA R4 NCAGCTWSCTNTSCTT ACSE CTGCTCTCTACGAAAGGCCGTGC ACSF ... GGTCTTGGCATAGTCATAGGT AC996F GCTACGCGTTCAGCACTATCAGATCGGG AC756F GCTACGCGTCCTTCCTAGCCCCACCT AC698F GCCACGCGTATCTATTAGCCTCGTCCCAC AC486F GATACGCGTCAGCCCGCCACATCTCAG AC374F GATACGCGC...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pdf
... the design of the study and the revision of the manuscript. All authors read and approved the final manuscript. Additional material Acknowledgements The authors thank the Haras Nationaux for the ... prepared the manuscript. XR participated in the computational analysis and preparation of the manuscript. CDB partici- pated in the preparation and the revision of the manu- sc...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pot
... 2005 Pr. extinction Agregate diversity and cryopreservation potential (Ollivier and Foulley, 2005) Loss or gain of diversity when a breed is removed and contributions to optimal diversity (Caballero ... Evolution 2009, 41:31 http://www.gsejournal.org/content/41/1/31 Page 3 of 3 (page number not for citation purposes) aggregate diversity D, which are now MER, LAND and POT, i...
Ngày tải lên: 14/08/2014, 13:21