Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
... for citation purposes)Genetic Vaccines and Therapy Open AccessResearchSilencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell ... stranded RNAsmall interference RNAnon small cell lung cancerAbstract Lung cancer has emerged as a leading cause of cancer death in the world. Non- small cell lung cancer (NSCLC)accounts for ... cispl-atin before and after transfection with dsRNA. Cisplatin is a commonly used chemical agent clinically. The experi-ment was performed by examining cells' viability using a MTT assay. As...
- 12
- 314
- 0
Báo cáo khoa học: Mutation of epidermal growth factor receptor is associated with MIG6 expression docx
... including the KEGG pathway database, PubMedabstracts and the Entrez Gene database, including Gene- RIF. ErbB and MAPK signaling pathway-related genesT. Nagashima et al. EGFR mutation and MIG6 ... to the manufacturer’s instructions. The probe was hybridized to the array for 16 h at 45 °C. The hybridized probe array was then washed and stainedaccording to an automated protocol for the Affymetrix ... directly associated with basal EGFR kinase activity. Cells might accumulateMIG6 to suppress excess EGFR activity; therefore,MIG6 may be regarded as a molecular marker for indicating the intrinsic...
- 13
- 347
- 0
Báo cáo khoa học: " Assessment of Epidermal Growth Factor Receptor (EGFR) expression in human meningioma" docx
... the manuscript. THparticipated in the design of the study and performed the statistical analysis.EHH and AP participated in case selection and provided patient material for analysis. DAW participated ... A significant association was determined when the benign and the atypical samples were compared to the malignant with respect to the SP (p = 0.009). While there was a range of the IHS for the ... newmolecular markers that may serve as potential therapeu-tic targets [21-28]. EGFR has emerged as one of the novelreceptors expressed on the surface of a variety of cancerssuch as colorectal, head...
- 7
- 302
- 0
Báo cáo y học: "Role of epidermal growth factor receptor activation in regulating mucin synthesis" pdf
... Munakata M , Nasuhara Y, Sato A, Takahashi T,Homma Y, Kawakami Y: Expression of epidermal growth factor and epidermal growth factor receptor immunoreactivity in the asthmatic human airway. Am J Respir ... goblet -cell metaplasia withoutchanging the total number of epithelial cells, indicatingthat the number of goblet cells increases and the numberof Clara cells decreases equivalently, thus implicating ... EGFRactivation and goblet -cell metaplasia.These studies of mechanical damage to airways may be of clinical relevance for two reasons. First, epithelialdamage is believed by some investigators...
- 5
- 375
- 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf
... peptidesf2–f6 was carried out on the same Gilson chromatographicapparatus using a PrePak Cart ridge 25 · 100 m m (Agilent)casted on a PrepLC Un iversal Base apparatus (Waters) and a Zorbax 300SB-C18 ... are in italics, the limit b etween the two EGF-repeats is shown by an a rrow. A model of the tandem repeats is also shown on top as a Ca trace. After a search for a suitable template with 3D-PSSM[38] ... reducedforms are similar but not identical (Fig. 4A) . A fit ofexperimental data with a three-parameter negative expo-nential curve (R > 0.99, data not shown) gave an apparentrate constant value...
- 12
- 416
- 0
Báo cáo sinh học: "Combined vascular endothelial growth factor-A and fibroblast growth factor 4 gene transfer improves wound healing in diabetic mice" pptx
... 5′-TCTTTCAATAAA-CAGCGTGCTG-3′ )andEF2(5′-GCGGTCAGCACAATGGCATA and 5′ -GACATCACCAAGGGTGTG-CAG-3′) were used. EF2 (elongation factor 2) was used as a housekeeping gene. After incubation for 15 min at95°C, ... Justyna Leja1, Anna Zagorska1, Aleksandra Sierpniowska1,Jacek Stepniewski1, Magdalena Kozakowska1, Hevidar Taha1, Takahiro Ochiya2, Rafal Derlacz3, Elisa Vahakangas4,Seppo Yla-Herttuala4, ... this article as: Jazwa et al.: Combined vascular endothelial growth factor- A and fibroblast growth factor 4 gene transfer improves woundhealing in diabetic mice. Genetic Vaccines and Therapy...
- 16
- 315
- 0
báo cáo hóa học: " Health state utilities for non small cell lung cancer" pot
... controlled tri-als comparing anti-biotic monotherapy (beta-lactams) for febrile neutropenia. Cefepime was associated with higherall-cause mortality at 30 days than other beta-lactams (RR1.44, ... dead. The utility value for the worst health state was determined against dead andthis was used to recalibrate the values for the other healthstates on the dead (0) to full health (1) scale. The ... health and worst health), were variedsequentially until the patient was indifferent betweenthem. Finally, the worst health state was assessed, basedon a gamble between full health and dead....
- 15
- 397
- 0
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... 352TAGGTGCATATAAACAAGAAGTAADAMTS-1 GCTGCCCTCACACTGCGGAAC 264CATCATGGGGCATGTTAAACACADAMTS-4 GCGCCCGCTTCATCACTG 101TTGCCGGGGAAGGTCACGADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196TGGGTTATTGCAGTGGCGGTAGGADAMTS-8 ... GATGTACCGAGGATTCACCAAGAT 356GCCGGATGCAAGCGTAGTTIMP-4 ATATTTATACGCCTTTTGATTCCT 297GGTACCCGTAGAGCTTCCGTTCCα2M GCCCGCTTTGCCCCTAACA 359TCGTCCACCCCACCCTTGATGRECK GTAATTGCCAAAAAGTGAAA 352TAGGTGCATATAAACAAGAAGTAADAMTS-1 ... 375CTGGGTTGAGGGGGCATCTTAGTGMMP-16 ACCCCAGGATGTCAGTGC 287AATAGCTTTACGGGTTTCAGGTIMP-1 TGGGCACCTGCACATCACC 277CATCTGGGCCCGCAAGGACTGTIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277TGTCCCAGGGCACGATGAAGTCTIMP-3 GATGTACCGAGGATTCACCAAGAT...
- 12
- 526
- 0
báo cáo khoa học: "Recent advances of novel targeted therapy in non-small cell lung cancer" pot
... WK,Tran H, Tsao A, Xie D, Ramies DA, Mass R, Seshagiri S, Eberhard DA,Kelley SK, Sandler A: Phase I/II trial evaluating the anti-vascularendothelial growth factor monoclonal antibody bevacizu-mab ... Biological agents in non- small cell lung can-cer: a review of recent advances and clinical results with a focus on epidermal growth factor receptor and vascularendothelial growth factor. J Thorac ... RS, Manegold C, Fukuoka M, KrisMG, Baselga J, Ochs JS, Haber DA: Epidermal growth factor receptor mutations and gene amplification in non- small- cell lung cancer: molecular analysis of the IDEAL/INTACT...
- 18
- 390
- 0
Báo cáo khoa học: Calmodulin-mediated regulation of the epidermal growth factor receptor doc
... negatively-charged inner leaflet of the plasma membrane becausethis agent is a weak base [93]. In any event, the actionof CaM on the downstream pathways of the EGFR,such as the Ras ⁄ mitogen-activated ... intracellular Ca2+oscillations in microvascularendothelial cells. J Cell Physiol 194, 139–150.31 Tanaka Y, Hayashi N, Kaneko A, Ito T, Miyoshi E,Sasaki Y, Fusamoto H & Kamada T (1992) Epidermal growth ... could form an antiparallel heli-cal dimer, and that the side chains of the basic aminoacids could interact with the negatively-charged innerleaflet of the plasma membrane [69].Kinetics measurements,...
- 16
- 459
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ