Báo cáo y học: "Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling" pot
... difference was between pre -selection thymocytes and selecting thymocytes (both positive and negative selection) . Negative selection was closer to the pre -selection condition than positive selection. Individual ... organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling Adrian Liston *¶ , Kristine Har...
Ngày tải lên: 14/08/2014, 17:22
... However, the changes of CD8+ T cell subsets during early period of ART have not been fully studied. Methods: Twenty-one asymptomatic treatment-naive HIV-infected patients with CD4 T+ cells less than ... RC: Highly active antiretroviral therapy results in a decrease in CD8+ T cell activation and preferential reconstitution of the peripheral CD4+ T cell population with memory...
Ngày tải lên: 10/08/2014, 05:22
... reported a series of 13 patients with ATL in 1976 on the occasion of the 16 th International Congress of Hematology in Kyoto, it was stated that 'attempt to elucidate leukemogenesis in this disease ... is the prototypic ATL in which patients exhibit increased number of ATL cells, frequent skin lesions, sys- temic lymphadenopathy, and hepatosplenomegaly. Most of these patients a...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: " Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms" pps
... 5'-CCTCTAAAAATAATAATAAATCCTC-3' 52 TaqI (pol) 2nd 5'-GGGTTTTTTGATTTGTTTAGTTTG-3' 5'-AAACTTACTAAAAAAATATCATCC-3' 51 4187 1st 5'-GGGTGAAATTGTGTAGTTTTGTAGG-3' 5'-CCTATTTTCAAACGAATCTACCTCC-3' ... 5'-CCAATAATAAACRACCAACCC-3' 45 TaqI (5'-LTR) 2nd 5'-GTTTTGTTTGATTTTGTTTGT-3' 5'-AAAAAAATTTAACCCATTACC-3' 49 1753 1st 5...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"
... [10]. The longer primer for detection of the wt allele was 5’-TTC AAG CCC TGA TGA TAA GGT CTT TGG CAT TAG ATG CTG TTT TGT TTT-3.’ The shorter primer was 5’-CTT TTG GCA TTA GAT GCT GTT TTG TCC TG-3.’ ... each of the further visits to the clinic. After 6 weeks the patients attended the clinic again and it is the lipid values and biometric data obtained at this visit which were used f...
Ngày tải lên: 31/10/2012, 17:03
Báo cáo y học: "Nature of Regulatory T Cells in the Context of Allergic Disease." ppsx
... IgG4- related immunity. 36 Neutralization of cytokine activity showed that T- cell suppression was induced by IL-10 and TGF-b during SIT and in normal immunity to the mucosal allergens. A deviation toward ... modified pattern. The ratio of T helper (Th)1 cytokines to Th2 cytokines is increased following SIT, and functional regulatory T cells are induced. Interleukin-10 production...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx
... accumulation in the inflamed joints, thus excluding the possibility that the lack of therapeutic activity was due to the inability of CD4 + CD25 + Treg to migrate into the inflamed tissue. The authors ... CD4 + CD25 + Treg can prevent the induction of autoimmunity but cannot ‘cure’ animals with ongoing autoimmunity. Thus it seems that the thresholds to control induction or progression (...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx
... and catabolic activity led us to speculate that a high-energy EMF may to some extent compro- mise the biosynthetic activity and/or function of articular chondrocytes. Although it is known that mechanical ... signal-to-noise ratio and thereby higher spatial resolution, their high field strength impairs the biosynthetic activity of articular chondrocytes in vitro. Although this decrease in...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... Briefly, commercially obtained telo- mere specific primers; CGGTTTGT TTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric ... (visually) in the spectra types of most of the 24 TCRVb types analyzed, it emerged from the initial analyses that the CD4 + T cell subset consistently exhib- ited normal spectra type...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... at RT, rinsed in 2 changes of distilled water, counterstained with hematoxylin, dehy- drated and mounted with resinous medium. Data analysis Numbers of patients with the T allele of the A203 3T ... 2.49 with 95% confidence interval, 1.23 < O.R. < 5.01). Data from the stratification of Crohn's patients and control patients by ethnicity (Table 2) sug- gest that the dif...
Ngày tải lên: 11/08/2014, 10:23