Báo cáo y học: "Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection" pps
Báo cáo y học: "Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection" pps
... secondary. Finally, the same genes were also compared to a database of IFN-α-associated transcripts as described in the Materials and methods. In the same panel the 637 genes are shown in a supervised-sample ... information Open Access 2007Panelliet al.Volume 8, Issue 1, Article R8 Research Sequential gene profiling of basal cell carcinomas treated with i...
Ngày tải lên: 14/08/2014, 17:22
Báo cáo y học: "Pro-inflammatory properties of stromal cell-derived factor-1 (CXCL12) in collagen-induced arthritis" pptx
... CXCL12 acts as a pro-inflammatory factor in the pathogenesis of autoimmune arthritis by attracting inflammatory cells to joints and by stimulating the differentiation and activation of osteoclasts. Introduction Among ... the chemokine family, CXCL12 may play a role in inflammatory dis- eases. Specifically, there is increasing evidence that CXCL12 plays a crucial role in...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "An experimental model of rhinovirus induced chronic obstructive pulmonary disease exacerbations: a pilot study" pps
... function changes typical of naturally occurring exacerbations. These were associated with evidence of viral replication and inflammatory cytokines in the upper airway. These findings suggest experimental ... spirometry and nasal lavage were performed and blood drawn for baseline serology. The subjects were seen daily for clinical review and nasal lavage on the 8 days post-in...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
... specimens. The authors thank Professor David M Findlay (Department of Orthopaedics and Trauma, Royal Adelaide Hospital, Adelaide, Australia) for the kind use of his laboratory for the undertaking of ... GTCAGCCAACTCGTCACAGTCC OPN Sense AGCCGTGGGAAGGACAGTTATG 472 62 29 NM_000582 Antisense GAGTTTCCATGAAGCCACAAAC IGF-I Sense GAGCCTGCGCAATGGAATAAAG 344 62 33 NM_000618 Antisense...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Global fitness profiling of fission yeast deletion strains by barcode sequencing" pptx
... 5'-AGCAGAAGACGGCATACGAGCCTTACT- TCGCATTTA-3'. For dntags, the forward primer (dnf-X) was 5'-CACGACGCTCTTCCGATCTXXXXCCAGT- GTCGAAAAGTATC-3', and the reverse primer (dnr) was ... normalized by total matched reads of the version 1.0 strains. Only uptag reads of the rad32 strain are plotted here. See Additional file 8 for the dntag reads of the rad32 s...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Digital expression profiling of novel diatom transcripts provides insight into their biological functions" doc
... 318:245-251. 24. Matsuzaki M, Misumi O, Shin-I T, Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Yoshida Y, Nishimura Y, Nakao S, Kobayashi T, Momoyama Y, Higashiyama T, Minoda A, Sano ... Tanaka Y, Nakatsuma D, Harada H, Ishida M, Matsuda Y: Localization of soluble beta-carbonic anhydrase in the marine diatom Phaeodactylum tricornutum. Sorting to the chl...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Stable gene transfer of CCR5 and CXCR4 siRNAs by sleeping beauty transposon system to confer HIV-1 resistance" doc
... (5'-GATCCATGGTTGTTAGGACCTGGAG- GGGAAATCAATCCCCT-3', 5'-phosphate) was used for left IR/DR and splink SphI (5'-GTTGTTAGGACTGCTT- GGAGGGGAAAATCAATCAATCCCCT-3', 5'-phosphate) was used for ... resistance Mayur Tamhane and Ramesh Akkina* Address: Dept. Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado, 80523, USA Email: Mayu...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Multi-analyte profiling of ten cytokines in South African HIV-infected patients with Immune Reconstitution Inflammatory Syndrome (IRIS)" pdf
... IFN-g, and TNF -a) were analysed using a Human Cytokine 10-Plex Th1/Th2 assay (Bio-Rad, California, USA) and Luminex multi-analyte profiling technology (Bio-Rad, USA) accordin g to manufactu rer instructions. Plasma ... entered for each cytokine tested. Sam- ple information was entered; a ll standards and samples were assayed concurrently, on the same plates, in order to avoid int...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "NSP2 gene variation of the North American genotype of the Thai PRRSV in central Thailand" ppt
... Wassenaar AL, Spaan WJ, Gorbalenya AE, Snijder EJ: Alternative proteolytic processing of the arterivirus replicase ORF 1a polyprotein: evidence that NSP2 acts as a cofactor for the NSP4 serine protease. ... and North American (Type 2) genotype, respectively and displays a large degree of genetic variability, particularly at the nonstructural protein (nsp) 2 gene. This is th...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: " Global expression profiling of theophylline response genes in macrophages: evidence of airway anti-inflammatory regulation" ppsx
... AGTGTGCCTATTCCCTGAAAGAT IL-13 F155: TGAGGAGCTGGTCAACATCA 76 R230: CAGGTTGATGCTCCATACCAT IL-18 F211: GCTGAACCAGTAGAAGACAATTGC 94 R304: CCAGGTTTCATCATCTTCAGCTA IL-13Rα1 F495: GGAATACCAGTCCCGACACTAACT ... cAMP pathway and further inhibits the expression of LTC4 and LTD4. Conclusion These data may facilitate the understanding of the diverse anti-inflammatory effects of theophylline, a...
Ngày tải lên: 12/08/2014, 18:22