Báo cáo y học: "GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists" ppsx

... here for fileAdditional data file 2Results obtained by GENECODIS in the analysis of yeast and human gene setsA file containing the results obtained by GENECODIS in the analy-sis of the yeast and ... finding and point out that, in this particular case, the 'protein phos- phorylation' category is mainly related to proteins that are involved in cell cycle. Indeed, activat...

Ngày tải lên: 14/08/2014, 17:22

... Pandey A, Chinnaiyan AM: ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 2004, 6:1-6. 13. Edgar R, Domrachev M, Lash AE: Gene Expression Omnibus: NCBI gene ... summary page displays each list from the database that significantly matched the data, along with links to list annotations and Listmatch pages. (c) An example Listmatch page, which disp...

Ngày tải lên: 14/08/2014, 14:22

... 5 - GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al. [23]) and 50 ng cDNA at an annealing temperature (Ta) of 63°C for 35 cycles and the PCR products were separated on a 2.5% agarose ... genome. Nature 2009, 459:927-930. 13. Maher CA, Kumar-Sinha C, Cao X, Kalyana-Sundaram S, Han B, Jing X, Sam L, Barrette T, Palanisamy N, Chinnaiyan AM: Transcriptome sequencing to detect gene...

Ngày tải lên: 09/08/2014, 22:23

... a research ELISA, is an early predictive biomarker of acute kidney injury (AKI) after cardiopulmonary bypass (CPB).  e availability of a standardized clinical platform for NGAL measurements ... an ongoing search to identify early biomarkers of AKI that would play a role similar to that of troponin in acute myocardial infarction. Neutrophil Gelatinase-Associated Lipocalin (NG...

Ngày tải lên: 13/08/2014, 20:22

... pathways and networks. Trends Biochem Sci 33, 101–103. 33 Okuda S, Yamada T, Hamajima M, Itoh M, Katayama T, Bork P, Goto S & Kanehisa M (2008) KEGG atlas mapping for global analysis of metabolic ... multiple reactant pairs, and the one that appears in a KEGG metabolic pathway is called a main pair. To build a global reaction network, we used only compounds classified as main rea...

Ngày tải lên: 16/03/2014, 01:20

... array of cytokines, chemokines and cell adhesion molecules. TWEAK plays a role in tissue inflammation, repair and regeneration in many diseases, including SLE [5]. In a mouse model of SLE, the absence ... injury has anti- inflammatory effects [5]. In the current paper by Schwartz and colleagues, TWEAK was assessed as a biomarker for LN in both cross-sectional and longitudina...

Ngày tải lên: 09/08/2014, 14:22

... methods for annotation; a web graphical interface (MaGe) for data visualization and exploration; and the large Prokaryotic Genome DataBase (PkDGB) for data storage, which contains more than 400 ... by single, distinct, symmetric chromosomal inversions (Additional data file 1). To achieve an annotation as accurate as possible, we anno- tated 8013's genome manually by taking advant...

Ngày tải lên: 09/08/2014, 20:20

... Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick ... apparent false negative rate of approxi- mately 5% and a false discovery rate of approximately 19%. To systematically compare the miRTRAP and miRDeep methods, we tested the new Ciona lib...

Ngày tải lên: 09/08/2014, 20:21

... 11:R86 http://genomebiology.com/2010/11/8/R86 Page 6 of 13 are examples of metadata) - to repeat an analysis exactly. When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step. Galaxy’s metadata ... perform- ing computational analyses, systematically repeating ana- lyses, capturing all details of performed analyses, and annotating analyses....

Ngày tải lên: 09/08/2014, 20:22

... Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna. Partner manager – Roberto Grilli Italy: Center for the Evaluation ... relevant clinical practice guidelines (Clinical Practice Guidelines). It also discusses the why, what and how of measuring baseline performance defined as the measurement of actual clini- cal...

Ngày tải lên: 11/08/2014, 05:22