Báo cáo y học: "Genome re-annotation: a wiki solution" potx

... response after an 'adequate treatment', as defined by APA guidelines [8]. Additionally, in this partic- ular patient, a history of poor clinical response to ade- quate SSRI therapy, as well ... mainly due to a relatively low prevalence and difficulty in detection of clinical features. Therefore we have a lack of available data in the literature for AA, especially for the most...

Ngày tải lên: 08/08/2014, 23:21

... Suarez A, Junker P, Laustrup H, Gonza- lez-Escribano MF, Martin J, Abderrahim H, Alarcon-Riquelme ME: Functional variants in the B-cell gene BANK1 are associated with systemic lupus erythematosus. ... independently validated loci that, together with additional targets generated by larger GWAS, can be used to piece together the key pathways involved in lupus pathogenesis, with each...

Ngày tải lên: 09/08/2014, 14:22

... constructed for a reef-building coral, Acropora millepora. This map has ample resolution for QTL analysis (3.4 cM) and represents the first linkage map for a coral, as well as for any non-bilaterian mul- ticellular ... SW and LZ conducted DNA preparation, SNP and microsatellite genotyping, and linkage analysis. EM conducted comparative genome analys...

Ngày tải lên: 09/08/2014, 20:20

... 1.0 (a) (b) Log R ratio -1.0 -0.5 0.0 0.5 1.0 0.0 0.2 0.4 0.6 0.8 1.0 B Allele frequency MDA_175 MDA_468 AA AB AAB AABB ABB BB ABBB AABBB AAABB AAAB AA A AB BB B AAAB AABB ABBB BBB AAA AAB ABB ... GeneChip SNP 6.0 array. BLC_B1_T45 tumor sample measured on two SNP- array platforms, analyzed by using GAP, and superimposed by color code: (a) GAP for Affymetrix; and (b) GAP for...

Ngày tải lên: 09/08/2014, 20:20

... expansion of the cyclin gene family in diatoms and discovered a new cyclin class, the diatom- specific cyclins. The latter are most prob- ably involved in signal integration to the cell cycle because transcript ... Cryptosporidium parvum; Plafa, Plasmodium falciparum; Playo, Plasmodium yoelii yoelii; Thean, Theileria annulata; Thepa, Theileria parva; Parte, Paramecium...

Ngày tải lên: 09/08/2014, 20:21

... acetyl-CoA carboxylase; 2, 3-oxoacyl-ACP synthase; 3, 3-oxoacyl-ACP reductase; 4, 2-enoyl-ACP reductase; 5, methylmalonyl-CoA mutase; 6, methylmalonyl-CoA epimerase; 7, propionyl- CoA carboxylase; AAC, ... 3- hydroxyisobutyrate dehydrogenase; LC-ACS, long-chain acyl-CoA synthetase; MDH, malate dehydrogenase; OMC, oxoglutarate/malate carrier protein; Pyr C, pyruvate carboxylase; SCS, succinyl-...

Ngày tải lên: 09/08/2014, 22:24

... sequences of Human Adenovirus 14 isolates from mild respiratory cases and a fatal pneumonia, isolated during 2006-2007 epidemics in North America. Respiratory Research 2010 11:116. Submit your next manuscript ... [31], and in Germany from a severe case of acute respiratory disease foll owing a mili- tary training exercise (and ap parent...

Ngày tải lên: 12/08/2014, 11:22

... 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 NM_004281.3 BCL2 -associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... -2.4 ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transport...

Ngày tải lên: 13/08/2014, 01:20

... purposes) Retrovirology Open Access Research Characterization of a new 5' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein Stephen Valas* 1 , Morgane Rolland 1,2,4 , ... were Mar52 (5'-TAATCTGTGCAATACCAGAGCG- GCT-3'; nt 131 to 155; forward primer) and M3b. Primer pair MarN (5'-CAG...

Ngày tải lên: 13/08/2014, 06:20

... journal changed its name to Australasian Chiropractic & Osteopathy. It is this journal that has changed from a print journal to the Open Access, online journal Chiropractic & Osteopathy. The ... simon.french@coca.com.au; Melainie Cameron - melainie.cameron@coca.com.au * Corresponding author Abstract Both chiropractic and osteopathy are over a century old. They are now regard...

Ngày tải lên: 13/08/2014, 13:22

... of classifier performance No Yes No Yes NA NA No Yes NA NA Yes NA Reporting of prediction accuracy No Yes Yes Yes NA NA Yes Yes NA NA Yes NA Validation of data Cross validation of signature genes No Yes Yes Yes ... NA Adjustment for confounders No Yes Yes No NA NA No No No NA Yes Yes Raw data made publicly available No Yes Yes Yes Yes Yes No No No No Yes No PCR validation Yes No Yes Y...

Ngày tải lên: 14/08/2014, 07:21

... parameters are as fol- Table 1 Metabolic pathways that have been modelled by direct annota- tion of original literature data Pathway References Biosynthetic pathways Arabinogalactan [60,61] Mycolic ... The amounts of glycerol in the supernatant and in fresh medium were assayed by use of a commercial assay kit that employs a glycerokinase-coupled enzyme assay system (Boehringer Mannh...

Ngày tải lên: 14/08/2014, 07:21

... copy number is only one way to alter expression of a gene and expression of other oncogenes is much less tightly linked to DNA copy number or amplification. Other mechanisms for deregulation may ... expression of upstream genes. Tumor subtypes may also be distinguished by their propensity to amplify oncogenes, suggesting that the particular types of genomic instability present in a tumor...

Ngày tải lên: 14/08/2014, 07:21

... that are well annotated and, beyond that, to start recording the evidence used to annotate each gene. Another solution is to create a new, expanded database that can display all the alternative ... extra steps to find any genes missed by earlier steps; typically this involves running a translated search, aligning all six possible translations of the unannotated sections to a database. P...

Ngày tải lên: 14/08/2014, 17:22

... immigrants to Canada. The bank eventually failed because of bad real-estate loans - sounds familiar? - but Ponzi stayed on in Canada where eventually he was jailed for three years for check forgery. ... wasn't buying and selling postal reply coupons. In fact, he wasn't arbitraging anything. What he was actually doing was running what is called a pyramid scheme: as long as mone...

Ngày tải lên: 14/08/2014, 21:20