Báo cáo y học: "A Melanesian -thalassemia mutation suggests a novel mechanism for regulating gene expression" potx

Báo cáo y học: "A Melanesian -thalassemia mutation suggests a novel mechanism for regulating gene expression" potx

Báo cáo y học: "A Melanesian -thalassemia mutation suggests a novel mechanism for regulating gene expression" potx

... Biology 2006, 7:238 comment reviews reports deposited research interactions information refereed research Minireview A Melanesian ␣␣ -thalassemia mutation suggests a novel mechanism for regulating ... SNPs are important not only in medicine but also in basic molecular biology as they represent a natural library of variations that can be used to elucidate and validate...

Ngày tải lên: 14/08/2014, 17:22

3 137 0
Báo cáo y học: "Insights in to the pathogenesis of axial spondyloarthropathy based on gene expression profiles" ppt

Báo cáo y học: "Insights in to the pathogenesis of axial spondyloarthropathy based on gene expression profiles" ppt

... the manufacturer's recommendation. Microarray assays were performed in the Affymetrix Microarray Core, a unit of the OHSU Gene Microarray Shared Resource. Total RNA was amplified and labeled ... statistical package (Affymetrix, Inc, Santa Clara, CA, USA). The GC Robust Multiarray Analysis (GC- RMA) was used to adjust perfect match (PM) probe data for background noise [6]. Normaliza...

Ngày tải lên: 09/08/2014, 14:22

9 333 0
Báo cáo y học: "JNK pathway is involved in the inhibition of inflammatory target gene expression and NF-kappaB activation by melittin" ppsx

Báo cáo y học: "JNK pathway is involved in the inhibition of inflammatory target gene expression and NF-kappaB activation by melittin" ppsx

... Leica Microsystems AG, Wetzlar, Germany) equipped with a 630×oil immersion objective. Statistical analysis Data were analyzed using one-way analysis of variance followed by Tukey's test as a ... activates NF-kappaB transcriptional activity independently of IkappaB kinase gamma through a p38 MAPK-dependent RelA phos- phorylation pathway. Cell Signal 2004, 16(9):1023-1032. 41. de Hai...

Ngày tải lên: 11/08/2014, 08:22

13 388 0
Báo cáo y học: " Infection with hepatitis B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reports" pot

Báo cáo y học: " Infection with hepatitis B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reports" pot

... was the oppo- site. HBsAg and anti-HBs were evaluated by commercial radioimmunoassays (AusriaII and Ausab; Abbott Labora- tories, North Chicago, IL). HBeAg and anti-HBe were also evaluated by ... that they were both positive for HBsAg and nega- tive for anti-HBs. The elder daughter was positive for HBeAg and negative for antibody against hepatitis B e antigen (anti-HBe), while the you...

Ngày tải lên: 11/08/2014, 12:20

5 218 0
Báo cáo y học: "Characterization of heterotypic interaction effects in vitro to deconvolute global gene expression profiles in cancer" ppt

Báo cáo y học: "Characterization of heterotypic interaction effects in vitro to deconvolute global gene expression profiles in cancer" ppt

... forward GGAATACCTGAAGCCCTACGAA, reverse CCTGCAGACGT- CACAGATGGT; IFNα, forward CCTCGCCCTTTGCTT- TACTG, reverse GCCCAGAGAGCAGCTTGACT; IFNβ, forward ACCTCCGAAACTGAAGATCTCCTA, reverse TGCT- GGTTGAAGAATGCTTGA). ... concentration of 1× SYBR ® Green PCR Master Mix (ABI, Foster City, CA, USA) and 200 nM of each primer (sequences: GAPDH, forward GAAGGTGAAGGTCGGAGTC, reverse GAAGATGGTGATGGGATTTC; OAS...

Ngày tải lên: 14/08/2014, 08:20

17 231 0
Báo cáo y học: " The contributions of normal variation and genetic background to mammalian gene expression" ppsx

Báo cáo y học: " The contributions of normal variation and genetic background to mammalian gene expression" ppsx

... 5'-TCCAG- GGAAAACTGCTGACC-3'; Dnase 2a reverse, 5'- AGGAAAAGGCTGTCGGTGG-3'; Apoa4 forward, 5'- AGACAGGTGGTGGGGCAGGAC-3'; Apoa4 reverse, 5'- GCCCTCAGCCCATCACAGCAG-3'; Akr1e1 forward, 5'- CAAGGAGGGCGTGGTGAAGAG-3'; ... 5'- CAAGGAGGGCGTGGTGAAGAG-3'; Akr1e1 reverse, 5'-GCT- GGTGTGACTGGGTATGAC-3'; Cish forward, 5'-GGT- GGGG...

Ngày tải lên: 14/08/2014, 16:21

11 290 0
Báo cáo y học: " Full genome re-sequencing reveals a novel circadian clock mutation in Arabidopsis" doc

Báo cáo y học: " Full genome re-sequencing reveals a novel circadian clock mutation in Arabidopsis" doc

... PRR7), Hordeum vulgare subsp. vulgare (AAY17586, PRR), Arabidopsis thaliana (AAY62604, PRR3), Triticum aestivum (ABL09464, PRR), Oryza sativa Indica (BAD38858, PRR 37), Oryza sativa Indica (BAD38859, PRR73), ... was obtained from NASC and plants homozygous for the T-DNA were confirmed by PCR using primers 5’-ttgccgcagta a- caaaggtac -3’ ,5’-agtttatccggaagcaaatgg-3’ (WT band in Col-0, no b...

Ngày tải lên: 09/08/2014, 22:24

12 264 0
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

... M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the toll- like receptor 4/NF- kappa B pathway in saturated free fatty acids- induced inflammatory changes ... Health and Human Sciences, Georgia State University, Atlanta. Presented in part at the Experimental Biology Annual Meeting, April 2009, New Orleans, LA. Author details 1 Pathology and Laboratory ....

Ngày tải lên: 11/08/2014, 03:20

7 272 0
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

... M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the toll- like receptor 4/NF- kappa B pathway in saturated free fatty acids- induced inflammatory changes ... Health and Human Sciences, Georgia State University, Atlanta. Presented in part at the Experimental Biology Annual Meeting, April 2009, New Orleans, LA. Author details 1 Pathology and Laboratory ....

Ngày tải lên: 11/08/2014, 06:22

7 238 0
Báo cáo y học: "Cytomegalovirus-associated splenic infarcts in a female patient with Factor V Leiden mutation: a case report" docx

Báo cáo y học: "Cytomegalovirus-associated splenic infarcts in a female patient with Factor V Leiden mutation: a case report" docx

... lymphocytes. Atypical lymphocytes were observed on a blood smear. Alanine transaminase and aspartate transaminase levels were mildly elevated (59 and 64 U per Litre, respectively). An abdominal ... Weitzman Street, Tel-Aviv 64239, Israel Email: Lihi Atzmony - lihi _a@ hotmail.com; Nili Saar - nili.saar@gmail.com; Tamar Chundadze - tamar0102@gmail.com; Yaron Arbel - yaronarbel@gmail.com; Da...

Ngày tải lên: 11/08/2014, 19:21

3 400 0
Từ khóa:
w